GAP43 (NM_001130064) Human 3' UTR Clone

CAT#: SC208423

3`UTR clone of growth associated protein 43 (GAP43) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GAP43
• Synonyms: B-50; PP46
• ACCN: NM_001130064
• Insert Size: 595 bp
• Sequence Data:
  Insert Sequence

  >SC208423 3'UTR clone of NM_001130064
  The sequence shown below is from the reference sequence of NM_001130064. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTGACCAAGAACATGCCTGAACTCTAAGAAATGGCTTTCCACATCCCCACCCTCCCCTCTCCTGAGCCTG
  TCTCTCCCTACCCTCTTCTCAGCTCCACTCTGAAGTCCCTTCCTGTCCTGCTCACGTCTGTGAGTCTGTC
  CTTTCCCACCCACTAGCCCTCTTTCTCTCTGTGTGGCAAACATTTAAAAAAAAAAAAAAAAAGCAGGAAA
  GATCCCAAGTCAAACAGTGTGGCTTAAACATTTTTTGTTTCTTGGTGTTGTTATGGCAAGTTTTTGGTAA
  TGATGATTCAATCATTTTGGGAAATTCTTGCACTGTATCCAAGTTATTTGATCTGGTGCGTGTGGCCCTG
  TGGGAGTCCACTTTCCTCTCTCTCTCTCTCTCTGTTCCAAGTGTGTGTGCAATGTTCCGTTCATCTGAGG
  AGTCCAAAATATCGAGTGAATTCAAAATCATTTTTGTTTTCCTCCTTTTCAATGTGATGGAATGAACAAA
  AAGGAAAAAATTCAAAAAACCCAGTTTGTTTTAAAAATAAATAAATAAAGCAAATGTGCCAATTAGCGTA
  AACTTGCGGCTCTAAGGCTCCTTTTTCAACCCGAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001130064.1
• Summary: 'The protein encoded by this gene has been termed a 'growth' or 'plasticity' protein because it is expressed at high levels in neuronal growth cones during development and axonal regeneration. This protein is considered a crucial component of an effective regenerative response in the nervous system. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]'
• Locus ID: 2596