NAGPA (NM_016256) Human 3' UTR Clone

CAT#: SC208489

3`UTR clone of N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase (NAGPA) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "NAGPA"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol NAGPA
Synonyms APAA; UCE
ACCN NM_016256
Insert Size 667
Sequence Data
>SC208489 3'UTR clone of NM_016256
The sequence shown below is from the reference sequence of NM_016256. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CAGAGAAGGAGCAGCCAGGGGGCGCCCACAACCCCTTCAAGGACTGAAGCCTCAAGCTGCCCGGGGTGGC
ACGTCGCGAAAGCTTGTTTCCCCACGGTCTGGCTTCTGCAGGGGAAATTTCAAGGCCACTGGCGTGGACC
ATCTGGGTGTCCTCAGCCCCTGTGGGGCAGCCAAGTTCCTGATAGCACTTGTGCCTCAGCCCCTCACCTG
GCCACCTGCCAGGGCACCTGCAACCCTAGCAATACCATGCTCGCTGGAGAGGCTCAGCTGCCTGCTTCTG
GCCTGCCTGTGTCTGCTGCCGAGAAGCCCGTGCCCCCGGGAGGGCTGCCGCACTGCCAAAGAGTCTCCCT
CCTCCTGGGGAAGGGGCTGCCAACGAACCAGACTCAGTGACCACGTCATGACAGAACAGCACATCCTGGC
CAGCACCCCTGGCTGGAGTGGGTTAAAGGGACGAGTCTGCCTTCCTGGCTGTGACACGGGACCCCTTTTC
TACAGACCTCATCACTGGATTTGCCAACTAGAATTCGATTTCCTGTCATAGGAAGCTCCTTGGAAGAAGG
GATGGGGGGATGAGATCATGTTTACAGACCTGTTTTGTCATCCTGCTGCCAAGAAGTTTTTTAATCACTT
GAATAAATTGATATAATAAAAGGAGCCACCAGGTGGT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_016256.2
Summary Hydrolases are transported to lysosomes after binding to mannose 6-phosphate receptors in the trans-Golgi network. This gene encodes the enzyme that catalyzes the second step in the formation of the mannose 6-phosphate recognition marker on lysosomal hydrolases. Commonly known as 'uncovering enzyme' or UCE, this enzyme removes N-acetyl-D-glucosamine (GlcNAc) residues from GlcNAc-alpha-P-mannose moieties and thereby produces the recognition marker. The encoded preproprotein is proteolytically processed by furin to generate the mature enzyme, a homotetramer of two disulfide-linked homodimers. Mutations in this gene are associated with developmental stuttering in human patients. [provided by RefSeq, Oct 2015]
Locus ID 51172

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.