Cryptochrome I (CRY1) (NM_004075) Human 3' UTR Clone

CAT#: SC208534

3`UTR clone of cryptochrome 1 (photolyase-like) (CRY1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CRY1
• Synonyms: DSPD; PHLL1
• ACCN: NM_004075
• Insert Size: 662 bp
• Sequence Data:
  Insert Sequence

  >SC208534 3'UTR clone of NM_004075
  The sequence shown below is from the reference sequence of NM_004075. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGTCCTAAAGTCCAGAGACAGAGCACTAATTAGAAAACATTCAGGAGGAATACTGTTGCAGCTGAAATTG
  GTGGGGAGTTCAATACTTTTCAATTAAGTTATTTAAAAATATTCTTCATTGATGGAAAGCAGTTACATAT
  TGAAATATGTTGTTTCTAATGACATTTCTGTGGTTTTTAACTTTTTAATGAATTTCACAGAGGACAATTG
  GTAATTTGTATATAAAGAACTTGGCAAGAGAATTTGCTTAATGTAAATATAAACAGTCACAATTAGTATA
  GACCCATCGATATATTTTTGATAATTTTTCATGTATGGTAAAGTTAAAATGACAAATTGATATTCTGATA
  TAAAACTCAAAGTTTTGAAGTCAGTGGGAAAAAAGGAGGTTTTTAGACTTTCTTAAAAGACGTTAAAATT
  TTAGGACAGAATTTTCTTGATGTTGTTTGATCTAACTTTGCACTCTTTGATAATAATGTTTTAGATAATG
  TGCGTAATCCAAATTGGTATTGTAGCCTCTGTTAACACAGACAGTATATGTTTTAAACTTTGATGTAAAC
  CTTTTTAGACCCAAACTTGTGGAAGTATCATGTGTTAAGTTCTCTGTCTCTGTTTCTTTGTTCATTTATT
  ACTAAAATGAACTTGTTATTAAAGTATATGCA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004075.3
• Summary: 'This gene encodes a flavin adenine dinucleotide-binding protein that is a key component of the circadian core oscillator complex, which regulates the circadian clock. This gene is upregulated by CLOCK/ARNTL heterodimers but then represses this upregulation in a feedback loop using PER/CRY heterodimers to interact with CLOCK/ARNTL. Polymorphisms in this gene have been associated with altered sleep patterns. The encoded protein is widely conserved across plants and animals. Loss of the related gene in mouse results in a shortened circadian cycle in complete darkness. [provided by RefSeq, Jan 2014]'
• Locus ID: 1407