OS9 (NM_001017958) Human 3' UTR Clone

CAT#: SC208580

3`UTR clone of osteosarcoma amplified 9 endoplasmic reticulum lectin (OS9) transcript variant 4 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol OS9
Synonyms ERLEC2; OS-9
ACCN NM_001017958
Insert Size 646 bp
Sequence Data
>SC208580 3'UTR clone of NM_001017958
The sequence shown below is from the reference sequence of NM_001017958. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CTGGACGAATTTGACTTCTGAGACCAACACTACACTTGACCCTTCACGGAATCCAGACTCTTCCTGGACT
GGCTTGCCTCCTCCCCACCTCCCCACCCTGGAACCCCTGAGGGCCAAACAGCAGAGTGGAGCTGAGCTGT
GGACCTCTCGGGCAACTCTGTGGGTGTGGGGGCCCTGGGTGAATGCTGCTGCCCCTGCTGGCAGCCACCT
TGAGACCTCACCGGGCCTGTGATATTTGCTCTCCTGAACTCTCACTCAATCCTCTTCCTCTCCTCTGTGG
CTTTTCCTGTTATTGTCCCCTAATGATAGGATATTCCCTGCTGCCTACCTGGAGATTCAGTAGGATCTTT
TGAGTGGAGGTGGGTAGAGAGAGCAAGGAGGGCAGGACACTTAGCAGGCACTGAGCAAGCAGGCCCCCAC
CTGCCCTTAGTGATGTTTGGAGTCGTTTTACCCTCTTCTATTGAATTGCCTTGGGATTTCCTTCTCCCTT
TCCCTGCCCACCCTGTCCCCTACAATTTGTGCTTCTGAGTTGAGGAGCCTTCACCTCTGTTGCTGAGGAA
ATGGTAGAATGCTGCCTATCACCTCCAGCACAATCCCAGTGAAAAAGGTGTGAAGCACCCACCATGTTCT
TGAACAATCAGGTTTC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001017958.2
Summary This gene encodes a protein that is highly expressed in osteosarcomas. This protein binds to the hypoxia-inducible factor 1 (HIF-1), a key regulator of the hypoxic response and angiogenesis, and promotes the degradation of one of its subunits. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Locus ID 10956

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.