NDUFV3 (NM_021075) Human 3' UTR Clone

CAT#: SC208625

3`UTR clone of NADH dehydrogenase (ubiquinone) flavoprotein 3 10kDa (NDUFV3) nuclear gene encoding mitochondrial protein transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NDUFV3
• Synonyms: CI-9KD; CI-10k
• ACCN: NM_021075
• Insert Size: 633 bp
• Sequence Data:
  Insert Sequence

  >SC208625 3'UTR clone of NM_021075
  The sequence shown below is from the reference sequence of NM_021075. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAGTCACCTCGACACTGAGGGCCCTCGGTGTGAAGATGAACCTTCCACCGTCTTCACTGCATCCTGGAGT
  GCAAAAATAAAATCCACTCAAGAGTCACAAGGCCCGCTGTGCATAATCGGTTTCACTTTTACCTTTTTTT
  TTTTTTTTTTTTTTTTGAGACAGGGTCTCACTCTGTCACCCAGGCTGGAGTGCAGTGGCACATTCTCGGC
  TCACTGCAACTTCCGCCTCCTGGGTTCAAGTGATTCTCCCACCTCAGCCTCCCAAGTAGGTGGGATTACA
  GGTACTCACCACCAGGTCCAGCTAACTTTTGTATTTTTAGTAGAGACAGGGTTTCACCATGTTGGCCAGG
  CTGGTCTCGAACTCCTGACCTCAGATGGTCTGCCCACCTCCGCCTCCCAAAGTGCTGGGATTACAGGCGT
  GAGCCACTGCGCCCGGCCACTTTCACACTTTTTACAGTGAGTGGTGAATTAGCAACAGTAACACTGATTA
  TCCAACATATATTTTGGAATATCTACTATGTGCAAGGAATTTTTCTTAAACTCTAAGGTTATGAATCACT
  GGGCAAATCCATATAATTAGAGAATTTTAAGTGCTTTAGAGCGGTGTGATTCTACTGTGCTCAGCCTAGT
  CAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_021075.3
• Summary: 'The protein encoded by this gene is one of at least forty-one subunits that make up the NADH-ubiquinone oxidoreductase complex. This complex is part of the mitochondrial respiratory chain and serves to catalyze the rotenone-sensitive oxidation of NADH and the reduction of ubiquinone. The encoded protein is one of three proteins found in the flavoprotein fraction of the complex. The specific function of the encoded protein is unknown. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]'
• Locus ID: 4731