U2AF65 (U2AF2) (NM_001012478) Human 3' UTR Clone

CAT#: SC208641

3`UTR clone of U2 small nuclear RNA auxiliary factor 2 (U2AF2) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "U2AF2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol U2AF2
Synonyms U2AF65
ACCN NM_001012478
Insert Size 652 bp
Sequence Data
>SC208641 3'UTR clone of NM_001012478
The sequence shown below is from the reference sequence of NM_001012478. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCGACTCTTATCACCGCCGGGACTTCTGGTAGAGGCGGCTGGGGGAGGGTGGGGGCAGGGCTGGCTGGGG
GCTTCTCCCCACTCCCGCCCCCCCCTTATCCCCCTCTGAAGACGATGGGCAGAGGAGTGACAGCCGCAGA
CACACGACAGCCGGCAGCAACTGGAATGGCAGCAATTAAGGGTGGGGGGCGGGGGTTGGGGGGTTGGGGG
GTTAGGGCAGGGAGGGGACTGGGGAAGTGCGCACACAGCCCACACAGACAACACGCACCCACACAGACAC
AGAGGGAAGGGGTTGGGATGGGGACAGGGTGCACAGCAGGGCGGGGTAGGACCCCAGCCCCTCCCAAAAC
AGCCTCTCCTTCTCCCATAGACCCCTTTCTTCTCCCCTTCCCCACGGTAGGAACATAGCGTGTTTATATT
TTATGGCCAAACTATTTTGAATTTTGTTGTCCGGCCCTCAGTGCCCTGCCCTCTCCCTTACCAGGACCAC
AGCTCTGTTCCTTCGGCCTCTGGTCCTCTCTGGTCCCCTCCTGGGTTTCTTACGTAGTTGATTTTTCCTC
TTTAGTCTCCCCCGACCTGCGCCCAGCCCCGTGGCCCCTGCCCCTCTCCTACTCTCTGTGGCAGTTTCAT
ATTTGCTAAGACGAATTTGCTC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001012478.1
Summary U2 auxiliary factor (U2AF), comprised of a large and a small subunit, is a non-snRNP protein required for the binding of U2 snRNP to the pre-mRNA branch site. This gene encodes the U2AF large subunit which contains a sequence-specific RNA-binding region with 3 RNA recognition motifs and an Arg/Ser-rich domain necessary for splicing. The large subunit binds to the polypyrimidine tract of introns early during spliceosome assembly. Multiple transcript variants have been detected for this gene, but the full-length natures of only two have been determined to date. [provided by RefSeq, Jul 2008]
Locus ID 11338

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.