Noggin (NOG) (NM_005450) Human 3' UTR Clone

CAT#: SC208674

3`UTR clone of noggin (NOG) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NOG
• Synonyms: SYM1; SYNS1; SYNS1A
• ACCN: NM_005450
• Insert Size: 694
• Sequence Data:
  Insert Sequence

  >SC208674 3'UTR clone of NM_005450
  The sequence shown below is from the reference sequence of NM_005450. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CATTTCCGAGTGCAAGTGCTCGTGCTAGAACTCGGGGGCCCCCTGCCCGCACCCGGACACTTGATCGATC
  CCCACCGACGCCCCCTGCACCGCCTCCAACCAGTTCCACCACCCTCTAGCGAGGGTTTTCAATGAACTTT
  TTTTTTTTTTTTTTTTTTTTTTTCTGGGCTACAGAGACCTAGCTTTCTGGTTCCTGTAATGCACTGTTTA
  ACTGTGTAGGAATGTATATGTGTGTGTATATACGGTCCCAGTTTTAATTTACTTATTAAAAGGTCAGTAT
  TATACGTTAAAAGTTACCGGCTTCTACTGTATTTTTAAAAAAAAGTAAGCAAAAGAAAAAAAAAAGAACA
  GAGAAAAGAGAGACTTATTCTGGTTGTTGCTAATAATGTTAACCTGCTATTTATATTCCAGTGCCCTTCG
  CATGGCGAAGCAGGGGGGAAAAGTTATTTTTTTCTTGAAGTACAAAGAGACGGGGGAACTTTTGTAGAGG
  ACTTTTTAAAAGCTATTTTCCATTCTTCGGAAAGTGTTTTGGTTTTCCTTGGACCTCGAAGAAGCTATAG
  AGTTCAATGTTATTTTACAGTTATTGTAAATATAGAGAACAAATGGAATGACTAATCATTGTAAATTAAG
  AGTATCTGCTATTTATTCTTTATAATATCCCGTGTAGTAAATGAGAAAGAAGTGCAGAGCAGGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_005450.4
• Summary: The secreted polypeptide, encoded by this gene, binds and inactivates members of the transforming growth factor-beta (TGF-beta) superfamily signaling proteins, such as bone morphogenetic protein-4 (BMP4). By diffusing through extracellular matrices more efficiently than members of the TGF-beta superfamily, this protein may have a principal role in creating morphogenic gradients. The protein appears to have pleiotropic effect, both early in development as well as in later stages. It was originally isolated from Xenopus based on its ability to restore normal dorsal-ventral body axis in embryos that had been artificially ventralized by UV treatment. The results of the mouse knockout of the ortholog suggest that it is involved in numerous developmental processes, such as neural tube fusion and joint formation. Recently, several dominant human NOG mutations in unrelated families with proximal symphalangism (SYM1) and multiple synostoses syndrome (SYNS1) were identified; both SYM1 and SYNS1 have multiple joint fusion as their principal feature, and map to the same region (17q22) as this gene. All of these mutations altered evolutionarily conserved amino acid residues. The amino acid sequence of this human gene is highly homologous to that of Xenopus, rat and mouse. [provided by RefSeq, Jul 2008]
• Locus ID: 9241