CD151 (NM_139030) Human 3' UTR Clone

CAT#: SC208683

3`UTR clone of CD151 molecule (Raph blood group) (CD151) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CD151"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CD151
Synonyms GP27; MER2; PETA-3; RAPH; SFA1; TSPAN24
ACCN NM_139030
Insert Size 651 bp
Sequence Data
>SC208683 3'UTR clone of NM_139030
The sequence shown below is from the reference sequence of NM_139030. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GTACAGGAGTCTCAAGCTGGAGCACTACTGACCCTGCCTTGGGCCTTGCTGCTGCTGCACCCAACTACTG
AGCTGAGACCACTGAGTACCAGGGGCTGGGCTCCCTGATGACACCCACCCTGTGCCATCACCATAACCTC
TGGGGACCCCAACCTCAGAGGCAGCTTCAAGTGCCTTTTGCTGCGCACCAATGCCCAGCAGGGGAGGTGA
GGGGGGCTGGCGGGGCGAAGTTTGGGGGGTGTTTTGTGGGGCTCCCCAGACACACTCTCTGCCTGGTGGT
CAGATGCAGGTTGGAAGGGGCCTTGCTGAGTGGCGCAAGGCCGAGCGTTCCCAGCAGGGGGAGAAACCCT
TCACACCCCAGGCCCTTCAGGAACTGGGGCCTTGCCTTGCAGCCACATGGCCCCATCCCAGTTGGGGAAG
CCAGGTGAGCTCTGACCCTTGGGCCTGGGCCTCTGCCCCTCCCAACCCAGCCCTCGTCTCCCTCGACAGC
GCCCCTGCTGTCTTCCCCACCGCAGTCACCACCACCCGAAATGCCACGTGGTCACTGTGCACTGCCCTGT
TCATGTGCCTCTGCGGGGCAGGGCCTTCCTGGTTTTGTTCACTGCTGTACCCAGATGCCTACAACCATCC
CTGCCACATACAGGTGCTCAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_139030.3
Summary 'The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein that is known to complex with integrins and other transmembrane 4 superfamily proteins. It is involved in cellular processes including cell adhesion and may regulate integrin trafficking and/or function. This protein enhances cell motility, invasion and metastasis of cancer cells. Multiple alternatively spliced transcript variants that encode the same protein have been described for this gene. [provided by RefSeq, Jul 2008]'
Locus ID 977

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.