CD151 (NM_004357) Human 3' UTR Clone

CAT#: SC208684

3`UTR clone of CD151 molecule (Raph blood group) (CD151) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CD151
• Synonyms: GP27; MER2; PETA-3; RAPH; SFA1; TSPAN24
• ACCN: NM_004357
• Insert Size: 651 bp
• Sequence Data:
  Insert Sequence

  >SC208684 3'UTR clone of NM_004357
  The sequence shown below is from the reference sequence of NM_004357. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTACAGGAGTCTCAAGCTGGAGCACTACTGACCCTGCCTTGGGCCTTGCTGCTGCTGCACCCAACTACTG
  AGCTGAGACCACTGAGTACCAGGGGCTGGGCTCCCTGATGACACCCACCCTGTGCCATCACCATAACCTC
  TGGGGACCCCAACCTCAGAGGCAGCTTCAAGTGCCTTTTGCTGCGCACCAATGCCCAGCAGGGGAGGTGA
  GGGGGGCTGGCGGGGCGAAGTTTGGGGGGTGTTTTGTGGGGCTCCCCAGACACACTCTCTGCCTGGTGGT
  CAGATGCAGGTTGGAAGGGGCCTTGCTGAGTGGCGCAAGGCCGAGCGTTCCCAGCAGGGGGAGAAACCCT
  TCACACCCCAGGCCCTTCAGGAACTGGGGCCTTGCCTTGCAGCCACATGGCCCCATCCCAGTTGGGGAAG
  CCAGGTGAGCTCTGACCCTTGGGCCTGGGCCTCTGCCCCTCCCAACCCAGCCCTCGTCTCCCTCGACAGC
  GCCCCTGCTGTCTTCCCCACCGCAGTCACCACCACCCGAAATGCCACGTGGTCACTGTGCACTGCCCTGT
  TCATGTGCCTCTGCGGGGCAGGGCCTTCCTGGTTTTGTTCACTGCTGTACCCAGATGCCTACAACCATCC
  CTGCCACATACAGGTGCTCAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004357.4
• Summary: 'The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein that is known to complex with integrins and other transmembrane 4 superfamily proteins. It is involved in cellular processes including cell adhesion and may regulate integrin trafficking and/or function. This protein enhances cell motility, invasion and metastasis of cancer cells. Multiple alternatively spliced transcript variants that encode the same protein have been described for this gene. [provided by RefSeq, Jul 2008]'
• Locus ID: 977