MSL3L1 (MSL3) (NM_078630) Human 3' UTR Clone

CAT#: SC208742

3`UTR clone of male-specific lethal 3 homolog (Drosophila) (MSL3) transcript variant 2 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "MSL3"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol MSL3
Synonyms DKFZp586J1822; drosophila MSL3-like 1; male-specific lethal 3 homolog (Drosophila); male-specific lethal 3-like 1; MSL3L1; OTTHUMP00000022911; OTTHUMP00000022912
ACCN NM_078630
Insert Size 703
Sequence Data
>SC208742 3'UTR clone of NM_078630
The sequence shown below is from the reference sequence of NM_078630. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TGAGGCACATTACAGCACCAAGAACCCCCGGGCAATTTATTAAAATGTTGTTGGTTCTGTAAGAGCAACT
GCTCTGTCTAGTTTGGCGCTCTGGGTTCCAGGTGAATAACTAACAAGGTGGTGGGTCTTTACCCACAGCG
CAAACACAATGCCCACCTTGGGGCTCTGTTGTTTGAGTTGCCCACATACTGCAGTTATTCTGTTAGGAAT
GATTCCCTGGGTGCCTGAAAGTGCTCTGACACGACACTTGTTACTTTGCAGGCCATCTGTGATGGCAAGG
AAAAAGCAACTATGTTCACAGTGAAATATTCGTGGAATAGGTTAGGCCATTTCAGTAGACATTGCAGTTA
GTTAGCAAGAACCACATTGTCTCTTTATTTGTTAGCATTAAACAAATTTTTTTTTGCAAATTGGTTTTAT
TTTTTTGATGAAGCCGAGCAACTCTGTCCAAAAAGGTTTAGTTTGTACTCGGAAACCACAAAGTAGTCTC
AAAGTATTTTAGAGGGAATCGATATTGATGGCAAAAGAAAATTTGCAGCTATGCATTTGCTTCTAACGGT
TCCCTCTCTGTGAAACATTATTTTTGGTGATCTAAAGAAAGCATTGCCTTTCTTATTTGAGATTTTACAG
CTATACTTTGTTGTGTAATGTTATGGTTCCCTTTCTGTAAAATGTTATTTTTGGTGATCTAAATAAAGCC
TGT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_078630.1
Summary This gene encodes a nuclear protein that is similar to the product of the Drosophila male-specific lethal-3 gene. The Drosophila protein plays a critical role in a dosage-compensation pathway, which equalizes X-linked gene expression in males and females. Thus, the human protein is thought to play a similar function in chromatin remodeling and transcriptional regulation, and it has been found as part of a complex that is responsible for histone H4 lysine-16 acetylation. This gene can undergo X inactivation. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 2, 7 and 8. [provided by RefSeq, Jul 2010]
Locus ID 10943

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.