Folylpolyglutamate synthase (FPGS) (NM_004957) Human 3' UTR Clone

CAT#: SC208753

3`UTR clone of folylpolyglutamate synthase (FPGS) nuclear gene encoding mitochondrial protein transcript variant 1 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "FPGS"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol FPGS
Synonyms folylpoly-gamma-glutamate synthetase; folylpolyglutamate synthase; folylpolyglutamate synthetase; OTTHUMP00000022201; OTTHUMP00000022202; tetrahydrofolylpolyglutamate synthase
ACCN NM_004957
Insert Size 712 bp
Sequence Data
>SC208753 3'UTR clone of NM_004957
The sequence shown below is from the reference sequence of NM_004957. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TGGTGTCCTGAAGCTGCTGGAGCCCGCACTGTCCCAGTAGCCAAGGCCCGGGGTTGGAGGTGGGAGCTTC
CCACACCTGCCTGCGTTCTCCCCATGAACTTACATACTAGGTGCCTTTTGTTTTTGGCTTTCCTGGTTCT
GTCTAGACTGGCCTAGGGGCCAGGGCTTTGGGATGGGAGGCCGGGAGAGGATGTCTTTTTTAAGGCTCTG
TGCCTTGGTCTCTCCTTCCTCTTGGCTGAGATAGCAGAGGGGCTCCCCGGGTCTCTCACTGTTGCAGTGG
CCTGGCCGTTCAGCCTGTCTCCCCCAACACCCCGCCTGCCTCCTGGCTCAGGCCCAGCTTATTGTGTGCG
CTGCCTGGCCAGGCCCTGGGTCTTGCCATGTGCTGGGTGGTAGATTTCCTCCTCCCAGTGCCTTCTGGGA
AGGGAGAGGGCCTCTGCCTGGGACACTGCGGGACAGAGGGTGGCTGGAGTGAATTAAAGCCTTTGTTTTT
TAAAGAAATGGCAAAGCCTTCGACTGACCCTTGACCCCCTGCTCCCTCAGCAGAGACGGAGGGAGGGGCT
GCTGGTGGTCAGGGACCTGCACTGTGTAGAGGGAGCCTGGCTGTGTGGCCTGGAACAAGTCCCTCCCTCC
CTGTGCGCCTCAGGTGGCCTGTCTGTGAGATGAGAAGAAGACCAGACTGAAGCCTGTTCACCATATGCCA
GGCAGTGCTTTC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_004957.4
Summary 'This gene encodes the folylpolyglutamate synthetase enzyme. This enzyme has a central role in establishing and maintaining both cytosolic and mitochondrial folylpolyglutamate concentrations and, therefore, is essential for folate homeostasis and the survival of proliferating cells. This enzyme catalyzes the ATP-dependent addition of glutamate moieties to folate and folate derivatives. Alternative splicing results in transcript variants encoding different isoforms. [provided by RefSeq, Jan 2014]'
Locus ID 2356

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.