GIRK2 (KCNJ6) (NM_002240) Human 3' UTR Clone

CAT#: SC208784

3`UTR clone of potassium inwardly-rectifying channel subfamily J member 6 (KCNJ6) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "KCNJ6"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol KCNJ6
Synonyms BIR1; GIRK-2; GIRK2; hiGIRK2; KATP-2; KATP2; KCNJ7; KIR3.2; KPLBS
ACCN NM_002240
Insert Size 698 bp
Sequence Data
>SC208784 3'UTR clone of NM_002240
The sequence shown below is from the reference sequence of NM_002240. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TGGTGATGTGGCAAACCTGGAGAATGAATCCAAAGTTTAGTGCCCTAGCTGGGCAAACCCTTCTCTTCTC
CCCCCAACACAATCTTTCCTTGTCTCTCATTCTCTTTCTTTTTCTGTCTCTCTTGCTTTGTTCTTTATTT
GTTTATATTTAATTTTTACATGACCAGAAAACAAATCTTCAAGGTGTAAAATATCTACCTGCCCTCTCTC
AGTTATTCAGATTGACAAGGTAGACATGGATTTGATGAAAGTGCAAAGTGCCCTCATTTGTGGCCCAAGC
CTGGTCTCCTCCCAAAATACTACACATCCAACTCCTGGAGATTTCAGTTACTTACCTGCATGTGTTGTAC
AATACCAGATCACTCAAAAAGGTGTGTCAAAGATTTTACCTGGGATATGACAAGCAAGGTTTCTGGTGCC
TATTTATTCATTCAGTGAGACACAGAGTGGAGCCCTCAGTTTTATGGATCCCAATTCATTTCATCTACTA
CAGGGTGAGGTGCTTGCCCCCATGTGGGTGTGGCAGTTACAGGGCCCAGGTGAGCTGAAGACAAACCACT
GTACATATATATGCCTTATGTAATTATTTTCTTTTTGTAATTAGTAATAAAACCCAGCATGTACAAAAGT
ACCATAGAACAGAACTGCTAAATACTGTACATAGATGTATCATTAATGTAGGTTTAGATATATAACTT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_002240.2
Summary 'This gene encodes a member of the G protein-coupled inwardly-rectifying potassium channel family of inward rectifier potassium channels. This type of potassium channel allows a greater flow of potassium into the cell than out of it. These proteins modulate many physiological processes, including heart rate in cardiac cells and circuit activity in neuronal cells, through G-protein coupled receptor stimulation. Mutations in this gene are associated with Keppen-Lubinsky Syndrome, a rare condition characterized by severe developmental delay, facial dysmorphism, and intellectual disability. [provided by RefSeq, Apr 2015]'
Locus ID 3763

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.