DUSP2 (NM_004418) Human 3' UTR Clone

CAT#: SC208806

3`UTR clone of dual specificity phosphatase 2 (DUSP2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: DUSP2
• Synonyms: PAC-1; PAC1
• ACCN: NM_004418
• Insert Size: 644 bp
• Sequence Data:
  Insert Sequence

  >SC208806 3'UTR clone of NM_004418
  The sequence shown below is from the reference sequence of NM_004418. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAGGTGCTGTGTCACTGAGGTGGTGCCCCTCTGCCTGCCTGCCCCACTGTGCTGGCAGGAGCTGACTGTG
  GACTGGTGGGCTCCCCTCTGGGCCAGCACAGTCCCCTCACCTCTGGCAGGGCTGCTACCTCCTCAGAGTT
  TCAGAAGCCCCCACATGGGGGCTCTAGGAATGCCGGCATGCTGGTCTTTCCGACCTGGTGCTCTTCTGCT
  GGGGGACTGAGGCTGGCCCTCATTCGGGGTCGGGAACCAAGGGTGTGTCTGCTCTTTCCCTCCCCATCCT
  CTGGCAGAAATCAGCTAGACGCTATACCGTGGACTCTCCCTGGTCCACCACCATGTTGAAGCCCTTGGCA
  GCCTGAGAGCTCCAAGGAACAAGCTGTGACAACCAGGAGCCCTGTCTGTGGGTTCGTCTGCCCAGGGCCT
  GGAGCCCAAGCCCTGTGTTCCTGGGGAAGCTGGGGACTTGGGAAGTGATGGGTGTGTCATGTTGCGTGTG
  TCTGTCTGTGAGCCTTTCACACCTGTGCTGGCGCTGGAAAATTATTTGTGCTCAGCTGACATTTAACACT
  CCCTCCCCCGCTTCCTCCTAGCCCTGTGGGCAGGGGTTGGAAACTTAGCACTTTATATTTATACAGAACA
  TTCAGGATATGTCA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004418.3
• Summary: ' The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates ERK1 and ERK2, is predominantly expressed in hematopoietic tissues, and is localized in the nucleus. [provided by RefSeq, Jul 2008]'
• Locus ID: 1844