ABCB11 (NM_003742) Human 3' UTR Clone

CAT#: SC208868

3`UTR clone of ATP-binding cassette sub-family B (MDR/TAP) member 11 (ABCB11) for miRNA target validation


Reconstitution Protocol

USD 560.00

5 Days*

Size
    • 10 ug

Product Images

Other products for "ABCB11"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ABCB11
Synonyms ABC16; BRIC2; BSEP; PFIC-2; PFIC2; PGY4; SPGP
ACCN NM_003742
Insert Size 703
Sequence Data
>SC208868 3'UTR clone of NM_003742
The sequence shown below is from the reference sequence of NM_003742. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

ACTAGTCACCACTGGATCCCCCATCAGTTGACCCAATGCAAGAATCTCAGACACACATGACGCACCAGTT
ACAGGGGTTGTTTTTAAAGAAAAAAACAATCCCAGCAGGAGGGATTGCTGGGATTGTTTTTTCTTTAAAG
AAGAATGTTAATATTTTACTTTTACAGTCATTTTCCTACATCGGAATCCAAGCTAATTTCTAATGGCCTT
CCATAATAATTCTGCTTTAGATGTGTATACAGAAAATGAAAGAAACTAGGGTCCATATGAGGGAAAACCC
AATGTCAAGTGGCAGCTCAGCCACCACTCAGTGCTTCTCTGTGCAGGAGCCAGTCCTGATTAATATGTGG
GAATTAGTGAGACATCAGGGAGTAAGTGACACTTTGAACTCCTCAAGGGCAGAGAACTGTCTTTCATTTT
TGAACCCTCGGTGTACACAGAGGCGGGTCTATAACAGGCAATCAACAAACGTTTCTTGAGCTAGACCAAG
GTCAGATTTGAAAAGAACAGAAGGACTGAAGACCAGCTGTGTTTCTTAACTAAATTTGTCTTTCAAGTGA
AACCAGCTTCCTTCATCTCTAAGGCTAAGGATAGGGAAAGGGTGGATGCTCTCAGGCTGAGGGAGGCAGA
AAGGGAAAGTATTAGCATGAGCTTTCCAGTTAGGGCTGTTGATTTATGCTTTAACTTCAGAGTGAGTGTA
GGG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003742.2
Summary The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is the major canalicular bile salt export pump in man. Mutations in this gene cause a form of progressive familial intrahepatic cholestases which are a group of inherited disorders with severe cholestatic liver disease from early infancy. [provided by RefSeq, Jul 2008]
Locus ID 8647

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.