Neuraminidase (NEU1) (NM_000434) Human 3' UTR Clone

CAT#: SC208880

3`UTR clone of sialidase 1 (lysosomal sialidase) (NEU1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NEU1
• Synonyms: NANH; NEU; SIAL1
• ACCN: NM_000434
• Insert Size: 660 bp
• Sequence Data:
  Insert Sequence

  >SC208880 3'UTR clone of NM_000434
  The sequence shown below is from the reference sequence of NM_000434. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTCTATGGGACACTCTGAGCTGTGCCACTGCCACAGGGGTATTCTGCCTTCAGGACTCTGCCTTCAGGAA
  CACGGGTCTGTAGAGGGTCTGCTGGAGACGCCTGAAAGACAGTTCCATCTTCCTTTAGACTCCAGCCTTG
  GCAAAATCACCTTCCCTTTACCAGGGAAATCACTTCCTTTAGGACTGAAAGCTAGGCGTCCTCTCCCACA
  AAAAAGTCCTGCCCTCATCTGAGAATACTGTCTTTCCATATGGCTAAGTGTGGCCCCACCACCCTCTCTG
  CCCTCCCGGGACATTGATTGGTCCTGTCTTGGGCAGGTCTAGTGAGCTGTAGAATTGAATCAATGTGAAC
  TCAGGGAACTGGGGAAGGCTGAGCCTCCTCTTTGGTGTTGCGGTAAGATAACCGACAGGGCTGGTGAAAG
  TCCCCAGATGGCAGGATATTTGGTTTCAGAGTAAGGACTAGGTGCACCACCATGACTGACTATCAATCAA
  AATGTTTGTAACTTAAAATTTTTAATGAAGGATAATGAATATTTGTAGAGTCTCTATGGTTCTGTCAATG
  CACATCTTCGTGTCTGTTTTCCTCATGTATCCTTGTGAGCCTGGGTGAGTTCTGGGGAGAGACCTGATGT
  GCGTACTGCCTGTGAAAATCTGACTTTGGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000434.3
• Summary: 'The protein encoded by this gene is a lysosomal enzyme that cleaves terminal sialic acid residues from substrates such as glycoproteins and glycolipids. In the lysosome, this enzyme is part of a heterotrimeric complex together with beta-galactosidase and cathepsin A (the latter is also referred to as 'protective protein'). Mutations in this gene can lead to sialidosis, a lysosomal storage disease that can be type 1 (cherry red spot-myoclonus syndrome or normosomatic type), which is late-onset, or type 2 (the dysmorphic type), which occurs at an earlier age with increased severity. [provided by RefSeq, Jul 2008]'
• Locus ID: 4758