HOXB6 (NM_018952) Human 3' UTR Clone

CAT#: SC208895

3`UTR clone of homeobox B6 (HOXB6) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "HOXB6"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol HOXB6
Synonyms Hox-2.2; HOX2; HOX2B; HU-2
ACCN NM_018952
Insert Size 698 bp
Sequence Data
>SC208895 3'UTR clone of NM_018952
The sequence shown below is from the reference sequence of NM_018952. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGAGGAAGAAAAACAGGCCGAGTGAAGGTGCTGGAAAGGGAGGGAGGACGCGAGGGGAAAGGCCTGTGGG
GAGCCGAGGGCGTCAGAGAGACCCGGGAAGGAAGGCTCTCGGGTGGGGGAGCCAGGAGACCTGCTCTCCG
GCGCAGACAGGCGGGGCCCAGCGCTCTCCTGGACGCCCCCGCCCGCACAGCTCCCGGCGGGTGCTCTGAG
GCCTCACTACTCGAGCCCACCCAGCATCCCGCGCGCCCTTCCTTCCCGAGGAACTCGCCTCAGCCTGATC
AGGCTTCCTGGTGAGAACTGAGGAGCGGACTCACTTGATGTTTCCTGGAAGCAGAGCAAAATGCTCTTGT
CCCTGTCGCGTCTCATTTTGTCCATGTCCCCCGTGCACGGTTCAATGGTAGATTCGCTGTCCCCTCAGCG
GGGGCCTTGAAGACTCCCTGATCCCAGACCTGTCGTCTCTCCCACCCCCTCCCCAAAGCCACTGGAAGGA
GCACATACTACCTAGAAGTAAGAAGAGGAGCCTCAGAAGAAAACAAAGTTCTATTTTATTAATTTTCTAT
GTGTTGTGTTTGTAGTCTTGTCTTAGCTCTGGACGTGAAATACTTCGATGATGATGATGATGATGATGAT
GATAATAATAATAATAATAACAACAACAACAACAATAATAAAGATGTGAAAACTCGACGCTCGGTCAC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_018952.4
Summary 'This gene is a member of the Antp homeobox family and encodes a protein with a homeobox DNA-binding domain. It is included in a cluster of homeobox B genes located on chromosome 17. The encoded protein functions as a sequence-specific transcription factor that is involved in development, including that of lung and skin, and has been localized to both the nucleus and cytoplasm. Altered expression of this gene or a change in the subcellular localization of its protein is associated with some cases of acute myeloid leukemia and colorectal cancer. [provided by RefSeq, Jul 2008]'
Locus ID 3216

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.