Caspase 9 (CASP9) (NM_001229) Human 3' UTR Clone

CAT#: SC208909

3`UTR clone of caspase 9 apoptosis-related cysteine peptidase (CASP9) transcript variant alpha for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CASP9
• Synonyms: APAF-3; APAF3; ICE-LAP6; MCH6; PPP1R56
• ACCN: NM_001229
• Insert Size: 682 bp
• Sequence Data:
  Insert Sequence

  >SC208909 3'UTR clone of NM_001229
  The sequence shown below is from the reference sequence of NM_001229. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTTGCTTTAATTTCCTCCGGAAAAAACTTTTCTTTAAAACATCATAAGGCCAGGGCCCCTCACCCTGCCT
  TATCTTGCACCCCAAAGCTTTCCTGCCCCAGGCCTGAAAGAGGCTGAGGCCTGGACTTTCCTGCAACTCA
  AGGACTTTGCAGCCGGCACAGGGTCTGCTCTTTCTCTGCCAGTGACAGACAGGCTCTTAGCAGCTTCCAG
  ATTGACGACAAGTGCTGAACAGTGGAGGAAGAGGGACAGATGAATGCCGTGGATTGCACGTGGCCTCTTG
  AGCAGTGGCTGGTCCAGGGCTAGTGACTTGTGTCCCATGATCCCTGTGTTGTCTCTAGAGCAGGGATTAA
  CCTCTGCACTACTGACATGTGGGGCCAGGTCACCCTTTGCTGTGAGGCTGTCCTGTACATTGTGGGATGT
  TCAGCACTGTCCCTTGCCTCAATGCCAGTAACGCGTCTTCCTGAGTGGTGCCAAACAAAAAGGTTCTCAG
  GTGTTGCCAAATATGTCCTGGGGTATAAAACTTTCCTCGCCTGACAACCACTGGTCTGTAGGGATTTTTG
  GCTACACACAAACCAGTATCGCTCATAGATCAGCAAACCGGGGCCTACTAGAGTCTGAACAGCTGTAATC
  TATGAATTCTAAGTGAAATTTTAAAAATTGTTAATTTTTCCTATATTGCATT
  
  CGGACCGTTACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-RsrII
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001229.2
• Summary: 'This gene encodes a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. This protein can undergo autoproteolytic processing and activation by the apoptosome, a protein complex of cytochrome c and the apoptotic peptidase activating factor 1; this step is thought to be one of the earliest in the caspase activation cascade. This protein is thought to play a central role in apoptosis and to be a tumor suppressor. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]'
• Locus ID: 842