DUSP1 (NM_004417) Human 3' UTR Clone

CAT#: SC208918

3`UTR clone of dual specificity phosphatase 1 (DUSP1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: DUSP1
• Synonyms: CL100; HVH1; MKP-1; MKP1; PTPN10
• ACCN: NM_004417
• Insert Size: 681 bp
• Sequence Data:
  Insert Sequence

  >SC208918 3'UTR clone of NM_004417
  The sequence shown below is from the reference sequence of NM_004417. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCATTACGACCTCTCCCAGCTGCTGAAAGGCCACGGGAGGTGAGGCTCTTCACATCCCATTGGGACTCCA
  TGCTCCTTGAGAGGAGAAATGCAATAACTCTGGGAGGGGCTCGAGAGGGCTGGTCCTTATTTATTTAACT
  TCACCCGAGTTCCTCTGGGTTTCTAAGCAGTTATGGTGATGACTTAGCGTCAAGACATTTGCTGAACTCA
  GCACATTCGGGACCAATATATAGTGGGTACATCAAGTCCATCTGACAAAATGGGGCAGAAGAGAAAGGAC
  TCAGTGTGTGATCCGGTTTCTTTTTGCTCGCCCCTGTTTTTTGTAGAATCTCTTCATGCTTGACATACCT
  ACCAGTATTATTCCCGACGACACATATACATATGAGAATATACCTTATTTATTTTTGTGTAGGTGTCTGC
  CTTCACAAATGTCATTGTCTACTCCTAGAAGAACCAAATACCTCAATTTTTGTTTTTGAGTACTGTACTA
  TCCTGTAAATATATCTTAAGCAGGTTTGTTTTCAGCACTGATGGAAAATACCAGTGTTGGGTTTTTTTTT
  AGTTGCCAACAGTTGTATGTTTGCTGATTATTTATGACCTGAAATAATATATTTCTTCTTCTAAGAAGAC
  ATTTTGTTACATAAGGATGACTTTTTTATACAATGGAATAAATTATGGCAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004417.3
• Summary: 'The protein encoded by this gene is a phosphatase with dual specificity for tyrosine and threonine. The encoded protein can dephosphorylate MAP kinase MAPK1/ERK2, which results in its involvement in several cellular processes. This protein appears to play an important role in the human cellular response to environmental stress as well as in the negative regulation of cellular proliferation. Finally, the encoded protein can make some solid tumors resistant to both chemotherapy and radiotherapy, making it a target for cancer therapy. [provided by RefSeq, Aug 2017]'
• Locus ID: 1843