SAPK4 (MAPK13) (NM_002754) Human 3' UTR Clone

CAT#: SC208972

3`UTR clone of mitogen-activated protein kinase 13 (MAPK13) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MAPK13
• Synonyms: MAPK-13; MAPK 13; p38delta; PRKM13; SAPK4
• ACCN: NM_002754
• Insert Size: 708 bp
• Sequence Data:
  Insert Sequence

  >SC208972 3'UTR clone of NM_002754
  The sequence shown below is from the reference sequence of NM_002754. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGTGGCATGAAGCTGTAGGGACTCATCTTGCATGGCACCACCGGCCAGACACTGCCCAAGGACCAGTATT
  TGTCACTACCAAACTCAGCCCTTCTTGGAATACAGCCTTTCAAGCAGAGGACAGAAGGGTCCTTCTCCTT
  ATGTGGGAAATGGGCCTAGTAGATGCAGAATTCAAAGATGTCGGTTGGGAGAAACTAGCTCTGATCCTAA
  CAGGCCACGTTAAACTGCCCATCTGGAGAATCGCCTGCAGGTGGGGCCCTTTCCTTCCCGCCAGAGTGGG
  GCTGAGTGGGCGCTGAGCCAGGCCGGGGGCCTATGGCAGTGATGCTGTGTTGGTTTCCTAGGGATGCTCT
  AACGAATTACCACAAACCTGGTGGATTGAAACAGCAGAACTTGATTCCCTTACAGTTCTGGAGGCTGGAA
  ATCTGGGATGGAGGTGTTGGCAGGGCTGTGGTCCCTTTGAAGGCTCTGGGGAAGAATCCTTCCTTGGCTC
  TTTTTAGCTTGTGGCGGCAGTGGGCAGTCCGTGGCATTCCCCAGCTTATTGCTGCATCACTCCAGTCTCT
  GTCTCTTCTGTTCTCTCCTCTTTTAACAACAGTCATTGGATTTAGGGCCCACCCTAATCCTGTGTGATCT
  TATCTTGATCCTTATTAATTAAACCTGCAAATACTCTAGTTCCAAATAAAGTCACATTCTCAGGTTCCAG
  GTGGACAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002754.3
• Summary: 'This gene encodes a member of the mitogen-activated protein (MAP) kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. The encoded protein is a p38 MAP kinase and is activated by proinflammatory cytokines and cellular stress. Substrates of the encoded protein include the transcription factor ATF2 and the microtubule dynamics regulator stathmin. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jul 2012]'
• Locus ID: 5603