ACOX3 (NM_003501) Human 3' UTR Clone

CAT#: SC209000

3`UTR clone of acyl-Coenzyme A oxidase 3 pristanoyl (ACOX3) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ACOX3"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ACOX3
Synonyms acyl-Coenzyme A oxidase 3; pristanoyl
ACCN NM_003501
Insert Size 703
Sequence Data
>SC209000 3'UTR clone of NM_003501
The sequence shown below is from the reference sequence of NM_003501. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GTGAACAAACCTGTCATAGGAAGTCTGAAATCGAAGCTCTAGTGGGACTGGCACACATTCAGCCAAGTCT
AATGAAACGAAGGGAACTAATCAGACGTGGACCTCAACTTCTGATTCCAGAACACGCCGGAGATTGCTGC
TGCTTTCTGAGCCCGCACCTGTGCGCCTAAACTGCTGATTGGCCTCAACTGCCCAGGCGGACGGGAGGGA
GGCACCCGGCCGGCTGGACTAATCTGGGATCGCGGTGATTTGCAGCGTGGAAAAGAAATGCAGATGATCA
TGTCTACCTGATGCGCCGTGGGTTTTTTGATAATTAGAATTTCGCACATTCAGTTTTCAGGGTTCAGCTC
CTTTCTCTAAAGTAAACAGCCCATTGTCAGGGATCTTCTGGTCAGACAACCTGTGATTCATCTAGATTTT
TTACCGAGCTCCACTTCATTGAGAAGTCAATGATGCCAGTCTGGTTCTTTGTCAACTCTCCCTCGGCTTT
GTCACATAATTGAATTATGTCATAACCTTATTAATTTGCACATAGATCATCTGAATGTCGTGGTTTAAGA
CTTAAGGAGGAACATCTGTTTGATTACTTTCTTTTGTGGAACTGGAAATTTCCATCGAGGAAATGTTTTT
TTAAAAAGTCTAATGATTTGAATGGGCAATTCAGTCTCCAACCGCCCCCCTCCCCCTGCCGCCAGTTATA
TAC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003501.2
Summary Acyl-Coenzyme A oxidase 3 also know as pristanoyl -CoA oxidase (ACOX3)is involved in the desaturation of 2-methyl branched fatty acids in peroxisomes. Unlike the rat homolog, the human gene is expressed in very low amounts in liver such that its mRNA was undetectable by routine Northern-blot analysis or its product by immunoblotting or by enzyme activity measurements. However the human cDNA encoding a 700 amino acid protein with a peroxisomal targeting C-terminal tripeptide S-K-L was isolated and is thought to be expressed under special conditions such as specific developmental stages or in a tissue specific manner in tissues that have not yet been examined. [provided by RefSeq, Jul 2008]
Locus ID 8310

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.