DUSP26 (NM_024025) Human 3' UTR Clone

CAT#: SC209008

3`UTR clone of dual specificity phosphatase 26 (putative) (DUSP26) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "DUSP26"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol DUSP26
Synonyms DSP-4; DUSP24; LDP-4; LDP4; MKP-8; MKP8; NATA1; NEAP; SKRP3
ACCN NM_024025
Insert Size 679
Sequence Data
>SC209008 3'UTR clone of NM_024025
The sequence shown below is from the reference sequence of NM_024025. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGGGTCTGGAAGCATGAGGGGAGGGGGAGAGAGGTCAGGCCAGGCCCGTGGGTAGGTCCCTGGCTCCCAG
CTGGAGATAGGAGGCCCAGGTGGCAGGTAGCAGGAGGCCCAGATCACCCATCCTCCCCTGGGGTCAGGAG
AGGCCGAGCCCCAGGCCACTGTCACTCTTTGTGGGAGGGGACGGGGAGTGAGGTTGGGCAGTGTGGTGGA
TGGGCACCCAGGAAGGGTTGACCAGGGAAGGAGGCAGCTAGGCTGTAGATGGAAGATGGTCCTGGGATTC
GAACACCGCTGGGATCTGGCCAGGGTGCTCCCTGGGATTCACAGTCCCTTCCCCTCTTTGTGCCCAAGTG
TTTCCCTCTCTCCCTCACCAAAACAAAAGGGCCATCTCTGCCCTGCACTTGTGCAGAAAGTCAGGGATAC
GGCAAGCATGAATGCAATGGTGTAGAGTTGTGTGAAACCCCTAGCATAGAGACAGACAGCGAAGAGATGG
TGTGAAAAGCTTGCAGAACCAGACAGAGAACCCCACAGACTTTCCACTCCAAGCACAGGAGGAGGTAGCT
AGCGTGTGAGGGTTGGCACTAGGCCCACGGCTGCTGCTTGGGCCAAAAACATACAGAGGTGCATGGCTGG
CAGTCTTGAAATTGTCACTCGCTTACTGGATCCAAGCGTCTCGAGGATA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_024025.1
Summary This gene encodes a member of the tyrosine phosphatase family of proteins and exhibits dual specificity by dephosphorylating tyrosine as well as serine and threonine residues. This gene has been described as both a tumor suppressor and an oncogene depending on the cellular context. This protein may regulate neuronal proliferation and has been implicated in the progression of glioblastoma through its ability to dephosphorylate the p53 tumor suppressor. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Locus ID 78986

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.