CSK (NM_001127190) Human 3' UTR Clone

CAT#: SC209062

3`UTR clone of c-src tyrosine kinase (CSK) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CSK
Synonyms MGC117393
ACCN NM_001127190
Insert Size 689 bp
Sequence Data
>SC209062 3'UTR clone of NM_001127190
The sequence shown below is from the reference sequence of NM_001127190. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GAGCACATCAAAACCCACGAGCTGCACCTGTGACGGCTGGCCTCCGCCTGGGTCATGGGCCTGTGGGGAC
TGAACCTGGAAGATCATGGACCTGGTGCCCCTGCTCACTGGGCCCGAGCCTGAACTGAGCCCCAGCGGGC
TGGCGGGCCTTTTTCCTGCGTCCCAGCCTGCACCCCTCCGGCCCCGTCTCTCTTGGACCCACCTGTGGGG
CCTGGGGAGCCCACTGAGGGGCCAGGGAGGAAGGAGGCCACGGAGCGGGAGGCAGCGCCCCACCACGTCG
GGCTTCCCTGGCCTCCCGCCACTCGCCTTCTTAGAGTTTTATTCCTTTCCTTTTTTGAGATTTTTTTTCC
GTGTGTTTATTTTTTATTATTTTTCAAGATAAGGAGAAAGAAAGTACCCAGCAAATGGGCATTTTACAAG
AAGTACGAATCTTATTTTTCCTGTCCTGCCCGTGAGGGTGGGGGGGACCGGGCCCCTCTCTAGGGACCCC
TCGCCCCAGCCTCATTCCCCATTCTGTGTCCCATGTCCCGTGTCTCCTCGGTCGCCCCGTGTTTGCGCTT
GACCATGTTGCACTGTTTGCATGCGCCCGAGGCAGACGTCTGTCAGGGGCTTGGATTTCGTGTGCCGCTG
CCACCCGCCCACCCGCCTTGTGAGATGGAATTGTAATAAACCACGCCATGAGGACACCG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001127190.1
Summary 'The protein encoded by this gene is involved in multiple pathways, including the regulation of Src family kinases. It plays an important role in T-cell activation through its association with the protein encoded by the protein tyrosine phosphatase, non-receptor type 22 (PTPN22) gene. This protein also phosphorylates C-terminal tyrosine residues on multiple substrates, including the protein encoded by the SRC proto-oncogene, non-receptor tyrosine kinase gene. Phosphorylation suppresses the kinase activity of the Src family tyrosine kinases. An intronic polymorphism (rs34933034) in this gene has been found to affect B-cell activation and is associated with systemic lupus erythematosus (SLE). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2017]'
Locus ID 1445

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.