CSK (NM_001127190) Human 3' UTR Clone

CAT#: SC209062

3`UTR clone of c-src tyrosine kinase (CSK) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CSK
• Synonyms: MGC117393
• ACCN: NM_001127190
• Insert Size: 689 bp
• Sequence Data:
  Insert Sequence

  >SC209062 3'UTR clone of NM_001127190
  The sequence shown below is from the reference sequence of NM_001127190. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAGCACATCAAAACCCACGAGCTGCACCTGTGACGGCTGGCCTCCGCCTGGGTCATGGGCCTGTGGGGAC
  TGAACCTGGAAGATCATGGACCTGGTGCCCCTGCTCACTGGGCCCGAGCCTGAACTGAGCCCCAGCGGGC
  TGGCGGGCCTTTTTCCTGCGTCCCAGCCTGCACCCCTCCGGCCCCGTCTCTCTTGGACCCACCTGTGGGG
  CCTGGGGAGCCCACTGAGGGGCCAGGGAGGAAGGAGGCCACGGAGCGGGAGGCAGCGCCCCACCACGTCG
  GGCTTCCCTGGCCTCCCGCCACTCGCCTTCTTAGAGTTTTATTCCTTTCCTTTTTTGAGATTTTTTTTCC
  GTGTGTTTATTTTTTATTATTTTTCAAGATAAGGAGAAAGAAAGTACCCAGCAAATGGGCATTTTACAAG
  AAGTACGAATCTTATTTTTCCTGTCCTGCCCGTGAGGGTGGGGGGGACCGGGCCCCTCTCTAGGGACCCC
  TCGCCCCAGCCTCATTCCCCATTCTGTGTCCCATGTCCCGTGTCTCCTCGGTCGCCCCGTGTTTGCGCTT
  GACCATGTTGCACTGTTTGCATGCGCCCGAGGCAGACGTCTGTCAGGGGCTTGGATTTCGTGTGCCGCTG
  CCACCCGCCCACCCGCCTTGTGAGATGGAATTGTAATAAACCACGCCATGAGGACACCG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001127190.1
• Summary: 'The protein encoded by this gene is involved in multiple pathways, including the regulation of Src family kinases. It plays an important role in T-cell activation through its association with the protein encoded by the protein tyrosine phosphatase, non-receptor type 22 (PTPN22) gene. This protein also phosphorylates C-terminal tyrosine residues on multiple substrates, including the protein encoded by the SRC proto-oncogene, non-receptor tyrosine kinase gene. Phosphorylation suppresses the kinase activity of the Src family tyrosine kinases. An intronic polymorphism (rs34933034) in this gene has been found to affect B-cell activation and is associated with systemic lupus erythematosus (SLE). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2017]'
• Locus ID: 1445