CBLB (NM_170662) Human 3' UTR Clone

CAT#: SC209114

3`UTR clone of Cas-Br-M (murine) ecotropic retroviral transforming sequence b (CBLB) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CBLB
• Synonyms: Cbl-b; Nbla00127; RNF56
• ACCN: NM_170662
• Insert Size: 730 bp
• Sequence Data:
  Insert Sequence

  >SC209114 3'UTR clone of NM_170662
  The sequence shown below is from the reference sequence of NM_170662. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TTTGCCTTCCCTCCTCCAGTATCCCCACGTCTAAATCTATAGCAGCCAGAACTGTAGACACCAAAATGGA
  AAGCAATCGATGTATTCCAAGAGTGTGGAAATAAAGAGAACTGAGATGGAATTCAAGAGAGAAGTGTCTC
  CTCCTCGTGTAGCAGCTTGAGAAGAGGCTTGGGAGTGCAGCTTCTCAAAGGAGACCGATGCTTGCTCAGG
  ATGTCGACAGCTGTGGCTTCCTTGTTTTTGCTAGCCATATTTTTAAATCAGGGTTGAACTGACAAAAATA
  ATTTAAAGACGTTTACTTCCCTTGAACTTTGAACCTGTGAAATGCTTTACCTTGTTTACAGTTTGGCAAA
  GTTGCAGTTTGTTCTTGTTTTTAGTTTAGTTTTGTTTTGGTGTTTTGATACCTGTACTGTGTTCTTCACA
  GACCCTTTGTAGCGTGGTCAGGTCTGCTGTAACATTTCCCACCAACTCTCTTGCTGTCCACATCAACAGC
  TAAATCATTTATTCATATGGATCTCTACCATCCCCATGCCTTGCCCAGGTCCAGTTCCATTTCTCTCATT
  CACAAGATGCTTTGAAGGTTCTGATTTTCAACTGATCAAACTAATGCAAAAAAAAAAAAGTATGTATTCT
  TCACTACTGAGTTTCTTCTTTGGAAACCATCACTATTGAGAGATGGGAAAAACCTGAATGTATAAAGCAT
  TTATTTGTCAATAAACTGCCTTTTGTAAGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_170662.3
• Summary: 'This gene encodes an E3 ubiquitin-protein ligase which promotes proteosome-mediated protein degradation by transferring ubiquitin from an E2 ubiquitin-conjugating enzyme to a substrate. The encoded protein is involved in the regulation of immune response by limiting T-cell receptor, B-cell receptor, and high affinity immunoglobulin epsilon receptor activation. Studies in mouse suggest that this gene is involved in antifungal host defense and that its inhibition leads to increased fungal killing. Manipulation of this gene may be beneficial in implementing immunotherapies for a variety of conditions, including cancer, autoimmune diseases, allergies, and infections. [provided by RefSeq, Sep 2017]'
• Locus ID: 868