PFKM (NM_000289) Human 3' UTR Clone

CAT#: SC209129

3`UTR clone of phosphofructokinase muscle (PFKM) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "PFKM"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol PFKM
Synonyms ATP-PFK; GSD7; PFK-1; PFK-A; PFK1; PFKA; PFKX; PPP1R122
ACCN NM_000289
Insert Size 714 bp
Sequence Data
>SC209129 3'UTR clone of NM_000289
The sequence shown below is from the reference sequence of NM_000289. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

ACCTGGAGCACATCACCCGGAAGCGGTCCGGGGAAGCTGCCGTCTAAACCTCTCTGGAGTGAGGGGAATA
GATTACCTGATCATGGTCAGCTCACACCCTAATAAGTCCACATCTTCTCAGTGTTTTAGCTGTTTTTTTC
ATTAGGTTTCCTTTTATTCTGTACCTTGCAGCCATGACCAGTTCTGGCCAGGAGCTGGAGGAGCAGGCAG
TGGGTGGGAGCTCCTTTTAGGTAGAATTTAACATGACTTCTGCCCCAGCTTTATCTGTCACACAAGGCTG
GGCACCTCTAGTGCTACTGCTAGATATCACTTACTCAGTTAGAATTTTCCTAAAAATAAGCTTTATTTAT
TTCTTTGTGATAACAAAGAGTCTTGGTTCCTCTACTACTTTTACTACAGTGACAAATTGTAACTACACTA
ATAAATGCCAACTGGTCACTGTGCTTTTGCTTCTCCTGTTATCATCTTCCTAAGTGGAATGTAATACTGT
CAGCCCCATGTATCAGACACTTGTCTGATGAAGCAGTAAAGACGTTAAGGGTATCACAGGGGGTGGAGGA
AGGGATTATCTCTAGTACACTACTTGCTGGCTGTCTGAAAAATTGTCACTGCCAAACTCTAAAAACAGTT
CTAAATAGTGACTGAGAAGGTTTGTTGCTGGAGTCAGGGAATAAGGCAGCCAAATACTCTTTGCACAGTT
CTTTAGTGGGAAGA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_000289.5
Summary 'Three phosphofructokinase isozymes exist in humans: muscle, liver and platelet. These isozymes function as subunits of the mammalian tetramer phosphofructokinase, which catalyzes the phosphorylation of fructose-6-phosphate to fructose-1,6-bisphosphate. Tetramer composition varies depending on tissue type. This gene encodes the muscle-type isozyme. Mutations in this gene have been associated with glycogen storage disease type VII, also known as Tarui disease. Alternatively spliced transcript variants have been described.[provided by RefSeq, Nov 2009]'
Locus ID 5213

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.