CBS (NM_000071) Human 3' UTR Clone

CAT#: SC209154

3`UTR clone of cystathionine-beta-synthase (CBS) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CBS
Synonyms CBSL; HIP4
ACCN NM_000071
Insert Size 709 bp
Sequence Data
>SC209154 3'UTR clone of NM_000071
The sequence shown below is from the reference sequence of NM_000071. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GACTTGCTGAACTTCGTGGCCGCCCAGGAGCGGGACCAGAAGTGAAGTCCGGAGCGCTGGGCGGTGCGGA
GCGGGCCCGCCACCCTTGCCCACTTCTCCTTCGCTTTCCTGAGCCCTAAACACACGCGTGATTGGTAACT
GCCTGGCCTGGCACCGTTATCCCTGCACACGGCACAGAGCATCCGTCTCCCCTCGTTAACACATGGCTTC
CTAAATGGCCCTGTTTACGGCCTATGAGATGAAATATGTGATTTTCTCTAATGTAACTTCCTCTTAGGAT
GTTTCACCAAGGAAATATTGAGAGAGAAGTCGGCCAGGTAGGATGAACACAGGCAATGACTGCGCAGAGT
GGATTAAAGGCAAAAGAGAGAAGAGTCCAGGAAGGGGCGGGGAGAAGCCTGGGTGGCTCAGCATCCTCCA
CGGGCTGCGCCGTCTGCTCGGGGCTGAGCTGGCGGGAGCAGTTTGCGTGTTTGGGTTTTTTAATTGAGAT
GAAATTCAAATAACCTAAAAATCAATCACTTGAAAGTGAACAATCAGCGGCATTTAGTACATCCAGAAAG
TTGTGTAGGCACCACCTCTGTCACGTTCTGGAACATTCTGTCATCACCCCGTGAAGCAATCATTTCCCCT
CCCGTCTTCCTCCTCCCCTGGCAACTGCTGATCGACTTTGTGTCTCTGTTGTCTAAAATAGGTTTTCCCT
GTTCTGGAC

CGGACCGTTACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-RsrII     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_000071.2
Summary 'The protein encoded by this gene acts as a homotetramer to catalyze the conversion of homocysteine to cystathionine, the first step in the transsulfuration pathway. The encoded protein is allosterically activated by adenosyl-methionine and uses pyridoxal phosphate as a cofactor. Defects in this gene can cause cystathionine beta-synthase deficiency (CBSD), which can lead to homocystinuria. This gene is a major contributor to cellular hydrogen sulfide production. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2016]'
Locus ID 875

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.