Axin 1 (AXIN1) (NM_003502) Human 3' UTR Clone

CAT#: SC209177

3`UTR clone of axin 1 (AXIN1) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: AXIN1
• Synonyms: AXIN; PPP1R49
• ACCN: NM_003502
• Insert Size: 684
• Sequence Data:
  Insert Sequence

  >SC209177 3'UTR clone of NM_003502
  The sequence shown below is from the reference sequence of NM_003502. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CATCGGCAAAGTGGAGAAGGTGGACTGATAGGCTGGTGGGCTGGCCGCTGTGCCAGGCGAGGCCCTTGGC
  GGGCACGGGTGTCACGGCCAGGCAGATGACCTCGTACTCAGGAGCCCGATGGGGAACAGTGTTGGGTGTA
  CCACCCATCCCTGTGGTCTACCCGTGTCTAGAGGCAGGTAGGGGGTCCCTCCAAGTGGTCCACAAGCTTC
  TGTCCTGCCCCCAAGGAGGCAGCCTGGACCACTCCTCATAGCAATACTTGGAGGGCCCAGCCCAAGTGAG
  GCAGCCGAGGTCCCTGCTGCCAGCTTCAGGTGACCCCCCCCCATCCCCCGGCACCTCCCTTGGGCACGTG
  TGCTGGGATCTACTTTCCCTCTGGGATTTGCCCACGTACCCAGGTCTGGGTGGGGCCCAGGCCCGGATGC
  AGAGGCCTGCAGGGCCTCTGTCAATTGTACGCGCCACCGAGTGCCTTCAACACAGCTTGTCTCTTGCCTG
  CCACTGTGTGAATCGGCGACGGAGCACTGCACCTGCCTCCAGCCGCCGGCTGTGCAGTCCTGGGTCCTCC
  TTTCTGAGGGCCCGTGTAAATATGTACATTTCTCAGGCTAGGCCAGCAGGGGCTGCCCGAGTCTGTTTTT
  CATGCGATGACACTTGTACAATTAATTATCTTTTCAAAGGTACTTGGATAATAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_003502.2
• Summary: This gene encodes a cytoplasmic protein which contains a regulation of G-protein signaling (RGS) domain and a dishevelled and axin (DIX) domain. The encoded protein interacts with adenomatosis polyposis coli, catenin beta-1, glycogen synthase kinase 3 beta, protein phosphate 2, and itself. This protein functions as a negative regulator of the wingless-type MMTV integration site family, member 1 (WNT) signaling pathway and can induce apoptosis. The crystal structure of a portion of this protein, alone and in a complex with other proteins, has been resolved. Mutations in this gene have been associated with hepatocellular carcinoma, hepatoblastomas, ovarian endometriod adenocarcinomas, and medullablastomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
• Locus ID: 8312