NFKB1 (NM_001165412) Human 3' UTR Clone

CAT#: SC209223

3`UTR clone of nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 (NFKB1) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "NFKB1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol NFKB1
Synonyms CVID12; EBP-1; KBF1; NF-kappa-B1; NF-kappaB; NF-kB1; NFkappaB; NFKB-p50; NFKB-p105; p50; p105
ACCN NM_001165412
Insert Size 745 bp
Sequence Data
>SC209223 3'UTR clone of NM_001165412
The sequence shown below is from the reference sequence of NM_001165412. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GATTATGGGCAGGAAGGACCTCTAGAAGGCAAAATTTAGCCTGCTGACAATTTCCCACACCGTGTAAACC
AAAGCCCTAAAATTCCACTGCGTTGTCCACAAGACAGAAGCTGAAGTGCATCCAAAGGTGCTCAGAGAGC
CGGCCCGCCTGAATCATTCTCGATTTAACTCGAGACCTTTTCAACTTGGCTTCCTTTCTTGGTTCATAAA
TGAATTTTAGTTTGGTTCACTTACAGATAGTATCTAGCAATCACAACACTGGCTGAGCGGATGCATCTGG
GGATGAGGTTGCTTACTAAGCTTTGCCAGCTGCTGCTGGATCACAGCTGCTTTCTGTTGTCATTGCTGTT
GTCCCTCTGCTACGTTCCTATTGTCATTAAAGGTATCACGGTCGCCACCTGGCATTCCTTCTGACCACAG
CATCATTTTGCATTCAAATTAAGGGTTAAGAAAAGAGATATTTTAAAATGAGAGTCACTTGATGTGCCAT
TTTAAAAAAAAAGGCATATTGCTTTTTCTAATGTGGTTATTTCTCTGATTTGCAAAAAAAAAAAAAAAAA
AAATACTTGTCAATATTTAAACATGGTTACAATCATTGCTGAAAATGGTATTTTCCCCCTTTTCTGCATT
TTGCTATTGTAAATATGTTTTTTAGATCAAATACTTTAAAGGAAAAAATGTTGGATTTATAAATGCTATT
TTTTATTTTACTTTTATAATAAAAGGAAAAGCAAATTGATGACCT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001165412.1
Summary 'This gene encodes a 105 kD protein which can undergo cotranslational processing by the 26S proteasome to produce a 50 kD protein. The 105 kD protein is a Rel protein-specific transcription inhibitor and the 50 kD protein is a DNA binding subunit of the NF-kappa-B (NFKB) protein complex. NFKB is a transcription regulator that is activated by various intra- and extra-cellular stimuli such as cytokines, oxidant-free radicals, ultraviolet irradiation, and bacterial or viral products. Activated NFKB translocates into the nucleus and stimulates the expression of genes involved in a wide variety of biological functions. Inappropriate activation of NFKB has been associated with a number of inflammatory diseases while persistent inhibition of NFKB leads to inappropriate immune cell development or delayed cell growth. NFKB is a critical regulator of the immediate-early response to viral infection. Alternative splicing results in multiple transcript variants encoding different isoforms, at least one of which is proteolytically processed. [provided by RefSeq, Aug 2020]'
Locus ID 4790

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.