NFKB1 (NM_001165412) Human 3' UTR Clone

CAT#: SC209223

3`UTR clone of nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 (NFKB1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NFKB1
• Synonyms: CVID12; EBP-1; KBF1; NF-kappa-B1; NF-kappaB; NF-kB1; NFkappaB; NFKB-p50; NFKB-p105; p50; p105
• ACCN: NM_001165412
• Insert Size: 745 bp
• Sequence Data:
  Insert Sequence

  >SC209223 3'UTR clone of NM_001165412
  The sequence shown below is from the reference sequence of NM_001165412. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GATTATGGGCAGGAAGGACCTCTAGAAGGCAAAATTTAGCCTGCTGACAATTTCCCACACCGTGTAAACC
  AAAGCCCTAAAATTCCACTGCGTTGTCCACAAGACAGAAGCTGAAGTGCATCCAAAGGTGCTCAGAGAGC
  CGGCCCGCCTGAATCATTCTCGATTTAACTCGAGACCTTTTCAACTTGGCTTCCTTTCTTGGTTCATAAA
  TGAATTTTAGTTTGGTTCACTTACAGATAGTATCTAGCAATCACAACACTGGCTGAGCGGATGCATCTGG
  GGATGAGGTTGCTTACTAAGCTTTGCCAGCTGCTGCTGGATCACAGCTGCTTTCTGTTGTCATTGCTGTT
  GTCCCTCTGCTACGTTCCTATTGTCATTAAAGGTATCACGGTCGCCACCTGGCATTCCTTCTGACCACAG
  CATCATTTTGCATTCAAATTAAGGGTTAAGAAAAGAGATATTTTAAAATGAGAGTCACTTGATGTGCCAT
  TTTAAAAAAAAAGGCATATTGCTTTTTCTAATGTGGTTATTTCTCTGATTTGCAAAAAAAAAAAAAAAAA
  AAATACTTGTCAATATTTAAACATGGTTACAATCATTGCTGAAAATGGTATTTTCCCCCTTTTCTGCATT
  TTGCTATTGTAAATATGTTTTTTAGATCAAATACTTTAAAGGAAAAAATGTTGGATTTATAAATGCTATT
  TTTTATTTTACTTTTATAATAAAAGGAAAAGCAAATTGATGACCT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001165412.1
• Summary: 'This gene encodes a 105 kD protein which can undergo cotranslational processing by the 26S proteasome to produce a 50 kD protein. The 105 kD protein is a Rel protein-specific transcription inhibitor and the 50 kD protein is a DNA binding subunit of the NF-kappa-B (NFKB) protein complex. NFKB is a transcription regulator that is activated by various intra- and extra-cellular stimuli such as cytokines, oxidant-free radicals, ultraviolet irradiation, and bacterial or viral products. Activated NFKB translocates into the nucleus and stimulates the expression of genes involved in a wide variety of biological functions. Inappropriate activation of NFKB has been associated with a number of inflammatory diseases while persistent inhibition of NFKB leads to inappropriate immune cell development or delayed cell growth. NFKB is a critical regulator of the immediate-early response to viral infection. Alternative splicing results in multiple transcript variants encoding different isoforms, at least one of which is proteolytically processed. [provided by RefSeq, Aug 2020]'
• Locus ID: 4790