IL15RA (NM_172200) Human 3' UTR Clone

CAT#: SC209286

3`UTR clone of interleukin 15 receptor alpha (IL15RA) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: IL15RA
• Synonyms: CD215
• ACCN: NM_172200
• Insert Size: 725 bp
• Sequence Data:
  Insert Sequence

  >SC209286 3'UTR clone of NM_172200
  The sequence shown below is from the reference sequence of NM_172200. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGAAAACTGCTCTCACCACCTATGAAACTCGGGGAAACCAGCCCAGCTAAGTCCGGAGTGAAGGAGCCTC
  TCTGCTTTAGCTAAAGACGACTGAGAAGAGGTGCAAGGAAGCGGGCTCCAGGAGCAAGCTCACCAGGCCT
  CTCAGAAGTCCCAGCAGGATCTCACGGACTGCCGGGTCGGCGCCTCCTGCGCGAGGGAGCAGGTTCTCCG
  CATTCCCATGGGCACCACCTGCCTGCCTGTCGTGCCTTGGACCCAGGGCCCAGCTTCCCAGGAGAGACCA
  AAGGCTTCTGAGCAGGATTTTTATTTCATTACAGTGTGAGCTGCCTGGAATACATGTGGTAATGAAATAA
  AAACCCTGCCCCGAATCTTCCGTCCCTCATCCTAACTTTCAGTTCACAGAGAAAAGTGACATACCCAAAG
  CTCTCTGTCAATTACAAGGCTTCTCCTGGCGTGGGAGACGTCTACAGGGAAGACACCAGCGTTTGGGCTT
  CTAACCACCCTGTCTCCAGCTGCTCTGCACACATGGACAGGGACCTGGGAAAGGTGGGAGAGATGCTGAG
  CCCAGCGAATCCTCTCCATTGAAGGATTCAGGAAGAAGAAAACTCAACTCAGTGCCATTTTACGAATATA
  TGCGTTTATATTTATACTTCCTTGTCTATTATATCTATACATTATATATTATTTGTATTTTGACATTGTA
  CCTTGTATAAACAAAATAAAACATC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_172200.1
• Summary: 'This gene encodes a cytokine receptor that specifically binds interleukin 15 (IL15) with high affinity. The receptors of IL15 and IL2 share two subunits, IL2R beta and IL2R gamma. This forms the basis of many overlapping biological activities of IL15 and IL2. The protein encoded by this gene is structurally related to IL2R alpha, an additional IL2-specific alpha subunit necessary for high affinity IL2 binding. Unlike IL2RA, IL15RA is capable of binding IL15 with high affinity independent of other subunits, which suggests distinct roles between IL15 and IL2. This receptor is reported to enhance cell proliferation and expression of apoptosis inhibitor BCL2L1/BCL2-XL and BCL2. Multiple alternatively spliced transcript variants of this gene have been reported.[provided by RefSeq, Apr 2010]'
• Locus ID: 3601