Perforin (PRF1) (NM_001083116) Human 3' UTR Clone

CAT#: SC209308

3`UTR clone of perforin 1 (pore forming protein) (PRF1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PRF1
• Synonyms: HPLH2; P1; PFP
• ACCN: NM_001083116
• Insert Size: 719 bp
• Sequence Data:
  Insert Sequence

  >SC209308 3'UTR clone of NM_001083116
  The sequence shown below is from the reference sequence of NM_001083116. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGAGCCTCCAGGAAACCGGAGTGGGGCCGTGTGGTGAGAACAGTGAGCTTGGAAAGGACCAGTATGCTTG
  GACTGAAGGGGTTCTCACAGTGGGAGCCAGGGCTGTCTTCGTATTCCCATTAGACCAAGCTTGTCCAACC
  CGAGGCCCGCATGCGGCCCAGGATGGCTTTGAATGCGGCCCAACGCAAATTCGCAAACTTTCTTAAAACA
  TTATGAGTTTCTTTTTGCTATTTTTTTTTTTTTTTTAGCTCATCGGCTATCGTTAGTGCTAGTGGATTTT
  ACATGTGGCCCAACACAATTCTTCTTCCAACGTGGCCCAGAGAAGCCAAAAGATTGGATACGCATCAGAC
  AGATGGAAAAGGGAGATTCAGACTGTTTTTCAGGGAGGTGGCTGGGTTTACACGCTAATCCCGATTCACC
  CTGTCCAAACTGCCTAAGCCCTCCGCCATTCTCAAGCCCTGCAGTCACAGCTACACAGATCACAGCTTCA
  GCCAGGAGCTGGGCAGAAGGCCAAGAGGCTGTTCCCACCAGGCTGCTCAGGGCTGGTCTTTTAGGACCCT
  TCCCTTGAGCCCTCTATGGTGTGGCAAAGCCTTCATTGCCTTAACTGGAGCCCCATCAGCTCCAGCTGCT
  CTGTCTTCTTTGCCCACAATGCTTTGCCCCTGAGACAAATGGAGGCCTGTCCTGACCTGTCTCACCATGT
  ACATAGCTTGATAAAGGGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001083116.1
• Summary: 'This gene encodes a protein with structural similarities to complement component C9 that is important in immunity. This protein forms membrane pores that allow the release of granzymes and subsequent cytolysis of target cells. Whether pore formation occurs in the plasma membrane of target cells or in an endosomal membrane inside target cells is subject to debate. Mutations in this gene are associated with a variety of human disease including diabetes, multiple sclerosis, lymphomas, autoimmune lymphoproliferative syndrome (ALPS), aplastic anemia, and familial hemophagocytic lymphohistiocytosis type 2 (FHL2), a rare and lethal autosomal recessive disorder of early childhood. [provided by RefSeq, Aug 2017]'
• Locus ID: 5551