Calretinin (CALB2) (NM_007088) Human 3' UTR Clone

CAT#: SC209318

3`UTR clone of calbindin 2 (CALB2) transcript variant CALB2c for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CALB2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CALB2
Synonyms CAB29; CAL2; CR
ACCN NM_007088
Insert Size 746 bp
Sequence Data
>SC209318 3'UTR clone of NM_007088
The sequence shown below is from the reference sequence of NM_007088. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CGGCTACATTGACGAGCATGAGCTGGATGCCCTTTTGAAGGATCTGTACGAGAAAAACAAAAAGGAAATG
AATATTCAACAGCTCACCAACTACAGAAAGAGCGTCATGTCCTTGGCAGAGGCAGGGAAGCTCTACCGCA
AGGACCTGGAGATTGTGCTCTGCAGCGAGCCCCCCATGTAAAGTGGGGACGGGGGCTGCTTCTCCACCTC
CCCCAAACCCTGCTTCTGCTGCCCTGATGCGTCTACCCAGACTCAGAGACCGTGAGCGCCCCGCCCCCAC
CCCTACAGCCTGCACACACCTGCCTGCAGAGCAGGAAATGAGAGATAGAGGATGGGCAGCTGGGGGGCTG
TCCTGAGCCCCCTGCACCCACCCCTGCCCAGGCAGTCTTTGCTCAGTGGATCACACACATGGAAGGTGAT
GGGGGCATGGGTGGAGGGTCCCTAATTCTCTTCGCTGTGATGCATGAGCTCCCTCGCTGTATGATTTAGG
CTTCTATGTCCAACAGAGTGGACTCTTCCCTCTCGCTCCCCTCTGCCGGTCCCCCATGCCACCACCCACC
CCAAACTTCCAGGTTCCATCCACCACCTTGCCAATGGTGTAGCTGTCCTCTCAGAACTCCTGTGTGTGGA
AGGCACCCGCCCTTTCCTTGCCTTCTTTACTCGGCGTGCTCCTTTTCTCTTTGGGTTTCTTGTTTACCAA
AGAAGAGTTTACAGACAATAAAATGGAAAGGTCCTGCTGTGGAAAC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_007088.2
Summary 'This gene encodes an intracellular calcium-binding protein belonging to the troponin C superfamily. Members of this protein family have six EF-hand domains which bind calcium. This protein plays a role in diverse cellular functions, including message targeting and intracellular calcium buffering. It also functions as a modulator of neuronal excitability, and is a diagnostic marker for some human diseases, including Hirschsprung disease and some cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2010]'
Locus ID 794

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.