CD89 (FCAR) (NM_133274) Human 3' UTR Clone

CAT#: SC209368

3`UTR clone of Fc fragment of IgA receptor for (FCAR) transcript variant 6 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: FCAR
• Synonyms: CD89; CTB-61M7.2; FcalphaRI
• ACCN: NM_133274
• Insert Size: 769 bp
• Sequence Data:
  Insert Sequence

  >SC209368 3'UTR clone of NM_133274
  The sequence shown below is from the reference sequence of NM_133274. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACTGGTCCTCGTGGCTCTCTTGGCCATACTGGTTGAAAATTGGCACAGCCATACGGCACTGAACAAGGAA
  GCCTCGGCAGATGTGGCTGAACCGAGCTGGAGCCAACAGATGTGTCAGCCAGGATTGACCTTTGCACGAA
  CACCAAGTGTCTGCAAGTAAACACCTGGAGGTGAAGGCAGAGAGGAGCCAGGACTGTGGAGTCCGACAAA
  GCTACTTGAAGGACACAAGAGAGAAAAGCTCACTAAGAAGCTTGAATCTACTTTTTTTTTTTTTTGAGAC
  AGAGTCTGGCTCTGTCACCCAGGCTGGAGTGCAGTGGAGCAATCTCGGCTCATTGAACCTCTTGGGTTCA
  AGTGATTCTTGTGCCTCAGCCTCCCAAGTAGCTGGAATTACAGGCACATACCACTGCACCCAGCTAATTT
  TTGTATTTTTAGTAGAGATGGGGTTTCACTGTGTTGGCCAGGCTGGTCTCGAACTCCTGACCTCAGGTGA
  TCCACCCACCTTGGCCTCCCAAAGTGCTGAGATTATAGGCATGAGCCACCACGCCTGGCCAGATGCATGT
  TCAAACCAATCAAATGGTGTTTTCTTATGCAGGACTGATCGATTTGCACCCACCTTTCTGCACATAAGTT
  ATGGTTTTCCATCTTATCTGTCTTCTGATTTTTTATATCCTGTTTAATTTCTTCCTTCATTGTTCTTCTC
  TTTTTTTATTTATTTTATTTATTTTTATTTTTATTTTTATTTGAGACAGAGTCTCACTCTGTTGCCCAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_133274.2
• Summary: 'This gene is a member of the immunoglobulin gene superfamily and encodes a receptor for the Fc region of IgA. The receptor is a transmembrane glycoprotein present on the surface of myeloid lineage cells such as neutrophils, monocytes, macrophages, and eosinophils, where it mediates immunologic responses to pathogens. It interacts with IgA-opsonized targets and triggers several immunologic defense processes, including phagocytosis, antibody-dependent cell-mediated cytotoxicity, and stimulation of the release of inflammatory mediators. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]'
• Locus ID: 2204