PPP2R2A (NM_002717) Human 3' UTR Clone

CAT#: SC209422

3`UTR clone of protein phosphatase 2 (formerly 2A) regulatory subunit B alpha isoform (PPP2R2A) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PPP2R2A
• Synonyms: B55A; B55ALPHA; PR52A; PR55A; PR55alpha
• ACCN: NM_002717
• Insert Size: 732 bp
• Sequence Data:
  Insert Sequence

  >SC209422 3'UTR clone of NM_002717
  The sequence shown below is from the reference sequence of NM_002717. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TTTCAAGACAAAGTGAATTAGGGTTGGCATTCCTAGCAGAAGAACCCACTTCCTGCTTAGTTGAGATAGT
  TGAATCTAGCATTCGTTCCTATAAAAGAGAGAGGTCCATTGTGGCGCCCCTTTCCAGTGTTTGACAGTGT
  GCCATTCGACAACACATTGTTATAGCTACATGGAGAAAGCTCTGTGGATTCATCACTGTGGTGTTCTCCA
  TGTCTGCTAGCCATTTAGGTAAGGGTAGGGCACTTTTAATTTAAATGACTTCTTGCACCATCTTGCCTAA
  TGGACTAGATTGGACTGTATCAACATTGATTTACTCCACTTTTTATGCCTTCCATTGTGATGACGTCAAA
  CACAGTGAAAGCCTTCAGTCATGCTATGGGATTTAATTGTGTATCCTCATTACTGTATCATTTGTGGGGT
  ACACCCCTTCCCCCTTTTTTTAAATTAAATACAGCTCATTCTTACTGTGGCTTGTAGCATTCCTCCTCTT
  CTGGCCTCCTGGACTGCTCCCCTTCATCTCTTACCCTTGCCCCCTCCACCCGGTCTTGGTGGTGGTATAT
  TAAAAAAAGAAAGAATGAAAGCACACAAAATGAGTCAGTTTGGGGTCAGTGGTATAAAGGGGGTATATGT
  TGCAAACAAATGTTTTAGTAACAGTTGGCTGTAATCACTCCTCGCCGTGTCTGGCACTGAAAATAAGGAA
  AAAAAACCTACTACTGAATAAAAGTGACAAAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002717.2
• Summary: 'The product of this gene belongs to the phosphatase 2 regulatory subunit B family. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes an alpha isoform of the regulatory subunit B55 subfamily. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2010]'
• Locus ID: 5520