COX7A2L (NM_004718) Human 3' UTR Clone

CAT#: SC209491

3`UTR clone of cytochrome c oxidase subunit VIIa polypeptide 2 like (COX7A2L) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: COX7A2L
• Synonyms: COX7AR; COX7RP; EB1; SIG81
• ACCN: NM_004718
• Insert Size: 746
• Sequence Data:
  Insert Sequence

  >SC209491 3'UTR clone of NM_004718
  The sequence shown below is from the reference sequence of NM_004718. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCTCTACATGGCTTCGCAGCCCAAAAACAAATGAGTTAGGCTGCAGAGGACTGGTTTGTTTTTTGGCATA
  AACCCTTTGAAGTTCCTTTTTCATTGTTAAATTAAAATTTTTTTTTTTACTTGGATGGCTTAACATTTTT
  GCAAGAAAAATAGGAAGATATGAAGATGATGTTTTGGTTTGTTTATGAAATGCATATGGCTTGTCAGAGC
  TCATTCGACAGTTAAAGCCATTGTTTAAAGAAATGGTGCTTTGCTCTGTGTTTGTGCTCCTGATTTCCCT
  GGAGGTTCTGGATGAAGGCTGAACACAGGCTTGTTAATGTCAGTCTGTGCTGAGGACCTCAGGGACTTGA
  GGTTGCATTTTTGAGCATGGGGTGCAGGAGCCTTTCTGGATTTGGATGTGGCTATGGAAAGAACACAGAA
  GCCAAGGTCATGTGCATGAAATGAGGAGTTTGAGTTAGTCACCTCGGGGATTTTTTCCATTTTGCAGTAA
  AATGTTAAATTAATGTAGCCTGCCTCTATTTGTTGGGCAGGTAATTTCAAAGGGTTATTTGCCTCATCTC
  CTATCTTTAGTGAAATCTTATGTGTAATTATTCCACCGTGGGAACAGAGAATACCTGTTTAGTGTTGCAC
  TTTAGACTGGTGTCTGTTTTGTTAATGCAGCTGTGCCACAAATTCTCCTTTATCTTTTAAAAATGTTATA
  GCTTTAAATTTTGATTTATTTTGACTGTGGAATAAATACATGAATG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_004718.2
• Summary: Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes a protein similar to polypeptides 1 and 2 of subunit VIIa in the C-terminal region, and also highly similar to the mouse Sig81 protein sequence. This gene is expressed in all tissues, and upregulated in a breast cancer cell line after estrogen treatment. It is possible that this gene represents a regulatory subunit of COX and mediates the higher level of energy production in target cells by estrogen. Several transcript variants, some protein-coding and others non-protein coding, have been found for this gene. [provided by RefSeq, Jan 2016]
• Locus ID: 9167