GRO beta (CXCL2) (NM_002089) Human 3' UTR Clone

CAT#: SC209527

3`UTR clone of chemokine (C-X-C motif) ligand 2 (CXCL2) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CXCL2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CXCL2
Synonyms CINC-2a; GRO2; GROb; MGSA-b; MIP-2a; MIP2; MIP2A; SCYB2
ACCN NM_002089
Insert Size 723 bp
Sequence Data
>SC209527 3'UTR clone of NM_002089
The sequence shown below is from the reference sequence of NM_002089. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GATGCTGAAAAATGGCAAATCCAACTGACCAGAAGGAAGGAGGAAGCTTATTGGTGGCTGTTCCTGAAGG
AGGCCCTGCCCTTACAGGAACAGAAGAGGAAAGAGAGACACAGCTGCAGAGGCCACCTGGATTGCGCCTA
ATGTGTTTGAGCATCACTTAGGAGAAGTCTTCTATTTATTTATTTATTTATTTATTTGTTTGTTTTAGAA
GATTCTATGTTAATATTTTATGTGTAAAATAAGGTTATGATTGAATCTACTTGCACACTCTCCCATTATA
TTTATTGTTTATTTTAGGTCAAACCCAAGTTAGTTCAATCCTGATTCATATTTAATTTGAAGATAGAAGG
TTTGCAGATATTCTCTAGTCATTTGTTAATATTTCTTCGTGATGACATATCACATGTCAGCCACTGTGAT
AGAGGCTGAGGAATCCAAGAAAATGGCCAGTGAGATCAATGTGACGGCAGGGAAATGTATGTGTGTCTAT
TTTGTAACTGTAAAGATGAATGTCAGTTGTTATTTATTGAAATGATTTCACAGTGTGTGGTCAACATTTC
TCATGTTGAAGCTTTAAGAACTAAAATGTTCTAAATATCCCTTGGACATTTTATGTCTTTCTTGTAAGGC
ATACTGCCTTGTTTAATGTTAATTATGCAGTGTTTCCCTCTGTGTTAGAGCAGAGAGGTTTCGATATTTA
TTGATGTTTTCACAAAGAACAGG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_002089.3
Summary 'This antimicrobial gene is part of a chemokine superfamily that encodes secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of the N-terminal cysteine residues of the mature peptide. This chemokine, a member of the CXC subfamily, is expressed at sites of inflammation and may suppress hematopoietic progenitor cell proliferation. [provided by RefSeq, Sep 2014]'
Locus ID 2920

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.