CHRM2 (NM_001006631) Human 3' UTR Clone

CAT#: SC209616

3`UTR clone of cholinergic receptor muscarinic 2 (CHRM2) transcript variant 5 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CHRM2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CHRM2
Synonyms HM2
ACCN NM_001006631
Insert Size 761 bp
Sequence Data
>SC209616 3'UTR clone of NM_001006631
The sequence shown below is from the reference sequence of NM_001006631. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GAACATAGGCGCTACAAGGTAAAATATCTTTGAAAAAGATAGAAGGTGGGCAAGGGGAGCTTGAGAAGAA
TAAAAGGGATAAACGAGCTCCTAGTTTTAAAATCTCTGCCATTGCACTTTATAGTCTGATTACAAAACGT
GCAATTCAGGAGCCCAGCAGTGACACACTTATCACGCCTAGGCTCCAGTTTGCAAAAATTGCACCTTATA
AACTGTCAGTATTAGGAGCAATGAGACAATGAAAGAAACATGTTGGGATCGTGGATTTAAGAAACTATAC
ACTGTTTCTCATAATCTCTTGAAGAAGGGCTTCTGATTCTACAATTTTATCAGTCTCTGCACAAGAGGAA
TAACCTTGTTCCTTTTTTGTTACTTTTGTTGTTGTTGTTCTCATGTGTCCTTAAGAGAAGGAAATGCCAC
AGTTACAAGGTAAACATGGAGACTTAAACATAAAGAAATAGGCACTATACAATGGGGACATAAAAAAAGA
AAATCAAAGAAGGATGCAGAAATTGTCTCCGGAGTGTTAAGCATATTTTATTCTTTTGTTACGGTCCTAT
TTAGAGGATTGGAATGTAATAAATGCTTATTTTTTGCCTTTCTTTTTCCCACCATGAAGAGAAAGCAAAC
AAACAGAAACCCCAACTAGGTCACACCATTTTTCTTCTTGTTATGCCACTATTTTGTACATCCCTGTTCT
ATATTGTTTATAGGGAAAACCTACAGGACTTTCACTAAAGCTAGCCAGAGACAGCCATGAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001006631.1
Summary 'The muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine to these receptors and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system. The muscarinic cholinergic receptor 2 is involved in mediation of bradycardia and a decrease in cardiac contractility. Multiple alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2008]'
Locus ID 1129

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.