Selenophosphate synthetase 2 (SEPHS2) (NM_012248) Human 3' UTR Clone

CAT#: SC209703

3`UTR clone of selenophosphate synthetase 2 (SEPHS2) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "SEPHS2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol SEPHS2
Synonyms SPS2; SPS2b
ACCN NM_012248
Insert Size 788
Sequence Data
>SC209703 3'UTR clone of NM_012248
The sequence shown below is from the reference sequence of NM_012248. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCTGACAGTTCAAATGCCTCCTCTGAGCCTAGCTCGTGAGATGAAAGAACAGAAGTTGTTTGGACCTTAG
AGCCATTGTCCACAATCACGGATGGTTCTCAAGAGTTGATTGTAAGAAATTTCCAAAGAAGGCTGCCTGC
ATAGTGGTTCCGGCTGCCCTTTCTAGGTGATTGGAATCAGCCCATCTAAAGCAGTCTTTATATGCATTCC
GAGGCCAGAGTAACATTTTGAACTTTGGGGGGATATTTGTTCATCACTTGGGTAGAAGAGGAGCAAAAAT
ACCTCTGTTTTCTCTTGCCAAAGTAAGATGAAGCTATTCCAGGTTGAGGGATTTTTCTTTGCACGGGGTT
GATTAATTTCTGCACAGGGAGTGAGATTATTAAAGTAACACACACACAAAGTAAATTGCAAAATGAAAAA
AATTAGAAGCAAATGAGTTTTGGACCAATATTGTTGATAAATCTAAATTGTTAAGAGAGATCTTATAATG
CAACATCAAATTCTTTATTCAATTTTACTGAAGTACTGGCTCTTTCCTGCTCTGGACAAGAATTGAGCAA
CTTGTCTGATGACTGGGAAAGGAGGACCTGCAACCATCTGACTTGGTCTCTGTTAATGACGTCTCTCCCT
CTAAACCCCATTAAGGACTGGGAGAGGCAGAGCAAGCCTCAGAGCCCAGGCCTCAGTGGTCATTAAGATG
TTAAGTCTTTTGCGGCAGATTCCTGGTGATTTGATCAATAAAGAGTAATTTCTTGCTAAATAAATAAAAG
AAACCTTGTTGAAAAACT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_012248.2
Summary This gene encodes an enzyme that catalyzes the production of monoselenophosphate (MSP) from selenide and ATP. MSP is the selenium donor required for synthesis of selenocysteine (Sec), which is co-translationally incorporated into selenoproteins at in-frame UGA codons that normally signal translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, the Sec insertion sequence (SECIS) element, which is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. This protein is itself a selenoprotein containing a Sec residue at its active site, suggesting the existence of an autoregulatory mechanism. It is preferentially expressed in tissues implicated in the synthesis of selenoproteins and in sites of blood cell development. A pseudogene for this locus has been identified on chromosome 5. [provided by RefSeq, May 2017]
Locus ID 22928

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.