DAZAP1 (NM_018959) Human 3' UTR Clone

CAT#: SC209736

3`UTR clone of DAZ associated protein 1 (DAZAP1) transcript variant 2 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "DAZAP1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol DAZAP1
Synonyms MGC19907
ACCN NM_018959
Insert Size 809
Sequence Data
>SC209736 3'UTR clone of NM_018959
The sequence shown below is from the reference sequence of NM_018959. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CAGAACCACAACGTGCAAGGGTTCCACCCCTACCGACGCTAGCCCGCGGCGCCGCGACGTCTGCACGGCC
CAGACCCAGGATTCCAAACTTGTGAACTCGTGACAATCACAAACTTGGCGGCAAAGTGGCGACTCAACCT
TGGGGGGGGGGGCGGGGGGAGGGCGCGAGGCTTTTGGAGCGGCTGTGGGTGTCGTCTGGACTGAGGTTTT
TAAATATTTCTTTCTCTAACCCATCAGCACAATAAAAAAAAGTCACTGGTTCAACAACAGGGTTTAAAAA
AAATGTCTTCAGCTTTAATTCAAAACTTCAGGTTTCTTTTTCTTCCTTTTTTTTGGAAATTATTTTCCTG
AGCCTTTTGTTTTACGGTATATTGTAAACTTTTATGTTAAAGAAAAAATATACATTTACAAATTGTGAGA
TTTTTAAGAGAAATTTTCTACGATGTATACTGGCTTATTTTTTAATTTAAAACGGGGTTTCCGTCGGCAC
TGGTGGAGGGGGTGCGCTGTTAGTCCCCTCGCTCCTGGCTTTGGGGGTTGGGACTTGGTGGTCCAGAAAC
TCTGGGAGCTTCTAGAAGAAATCTACTGAGTGTATTTCTGTTTTTTGTTTAATTCCTTGCTTTTGTCGAC
TGACCTGCTTGGTAGTGTCTGAGGTGAACTGTGGGGGTTGCGCACAGCCAGCCGCGTGGATCCCACGCAG
CGCTGAACCGAACCGAGTAGGAAGCCTTTCTCCCCAGGCACGTGGCTTCAGGGCGTTTCCCATTGACCAG
TTTGACCCTGGTTTGAATAAAGAGAAGTGCGTTTGGATT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_018959.2
Summary In mammals, the Y chromosome directs the development of the testes and plays an important role in spermatogenesis. A high percentage of infertile men have deletions that map to regions of the Y chromosome. The DAZ (deleted in azoospermia) gene cluster maps to the AZFc region of the Y chromosome and is deleted in many azoospermic and severely oligospermic men. It is thought that the DAZ gene cluster arose from the transposition, amplification, and pruning of the ancestral autosomal gene DAZL also involved in germ cell development and gametogenesis. This gene encodes a RNA-binding protein with two RNP motifs that was originally identified by its interaction with the infertility factors DAZ and DAZL. Two isoforms are encoded by transcript variants of this gene. [provided by RefSeq, Jul 2008]
Locus ID 26528

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.