GIT2 (NM_139201) Human 3' UTR Clone

CAT#: SC209774

3`UTR clone of G protein-coupled receptor kinase interacting ArfGAP 2 (GIT2) transcript variant 4 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GIT2
• Synonyms: CAT-2; CAT2; PKL
• ACCN: NM_139201
• Insert Size: 762
• Sequence Data:
  Insert Sequence

  >SC209774 3'UTR clone of NM_139201
  The sequence shown below is from the reference sequence of NM_139201. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AAGTTGCTTGGAAAAGATGCTAATTAATGAAGAGGAGCAACTACTATTGGTGTATTTTTCACAGATTGGT
  GCTTTCTAAATAAAAATTGAAAGTAACTCCTAACATTGAATGGGTTTGCTACTGAAAAAGTAATGATCTT
  CTGGTGCAAACAGTTGCTTGTGGACTTAAACCTTGGCACTGGTGGGGAATTTGGTCAGATTTTACAATCT
  CTGTCAAAGAGTAGACAGCTGAACTCACACCACACCCAGCTTATAGAATGTCCATGGAAGATGAAGGCGC
  ACCAGAAGGGAAGGACCCTGCGCAGAATGGACGTGGTGAATGGTGTTTAAAATGCCAGATGCCAAAGAGT
  AACACGATTCCCTGCTGACCCCTTAACTCTAATCCATCCAGCACCATGGAGCAGCCTGCATGTGAGGAAT
  GGAAGGAGCATTCAGGGCCTCCAAGTGACAGTCTCTAAAATGGGGTGGTGCCAGGCAGATTAGCATGTTC
  AAAGCTGACACCACTGAGGTCGTGTTTTTTGGGTGACAAAGCCAAAGGAGAGAAAGGCCAAATATTCCAG
  CCCTGGCCGAAAGATGATCACTCACCAGACGGAAGCAAGCGTGCTGCGTGGAGCATCCATGCGAAGATGT
  CAATTCCATAGATCAATAGGTTTCCAGTTTTCTTCGTGATATGTTAATATAGCAAACTTACCATGATCCG
  GTTTTCTCTTTTTTCTTTTTTTTTTTACAAAGTGCTGAATTGTTTGGAATATCAAGAGTATT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_139201.2
• Summary: This gene encodes a member of the GIT protein family, which interact with G protein-coupled receptor kinases and possess ADP-ribosylation factor (ARF) GTPase-activating protein (GAP) activity. GIT proteins traffic between cytoplasmic complexes, focal adhesions, and the cell periphery, and interact with Pak interacting exchange factor beta (PIX) to form large oligomeric complexes that transiently recruit other proteins. GIT proteins regulate cytoskeletal dynamics and participate in receptor internalization and membrane trafficking. This gene has been shown to repress lamellipodial extension and focal adhesion turnover, and is thought to regulate cell motility. This gene undergoes extensive alternative splicing to generate multiple isoforms, but the full-length nature of some of these variants has not been determined. The various isoforms have functional differences, with respect to ARF GAP activity and to G protein-coupled receptor kinase 2 binding. [provided by RefSeq, Sep 2008]
• Locus ID: 9815