NFYC (NM_001142587) Human 3' UTR Clone

CAT#: SC209914

3`UTR clone of nuclear transcription factor Y gamma (NFYC) transcript variant 3 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "NFYC"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol NFYC
Synonyms CBF-C; CBFC; H1TF2A; HAP5; HSM; NF-YC
ACCN NM_001142587
Insert Size 763 bp
Sequence Data
>SC209914 3'UTR clone of NM_001142587
The sequence shown below is from the reference sequence of NM_001142587. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGGTGACCGGCGACTGAGGGCCTGAGCTGGCAAGGCCAAGGACACCCAACACAATTTTTGCCATACAGCC
CCAGGCAATGGGCACAGCCTTCCTCCCCAGAGGACCCGGCCGACCTCAGCGCCTCCTGCAGGCTAGGACA
CTGGTGCACTACACCCCATGCCTGGGGGCCGAGATTCTCCAGCAGAAAGATGCAATATTTTTTGTTTCCT
TTTTTTCCATTTTTTTCTCTAAGGAATCAATATTTCAATATGTTGAGTGTGTGTCCAATGCTATGAAATT
AAAATATTAAATAACATATTTATGGCATTTTCTTGAAGAGTGTGGTTGAAGAAATATTTCTCCTTTTGTT
TTTCTTTTTTTTTTGTTTGTTACTGCCACTTCTTTTTAGGAGCAAATCTCCCCAGGGGTGTACGGTATTT
CTTGACTCTGGGAACAGCTGCTACCCCCAAGACTTGCCACGTTGTTCTGCCCTCAGATGGAATTAGGTGA
ATGTGTGTAGCTGCTTTTTCACTCGTGGTCCTCTCCCCATCCCTTGCTCTGACCCCAGAGCTCTGTGTAT
TTGCATCCAGAGGCCATGGAAACATTCTTTGCATTTAAGAGACAGATTTATTCCCTGTGGAGAGTGGGTG
GATTCATTGCCACACTCTTTTCTCCCAGGGACCCAGGAAACTAGGACTTTGTGTGTTTGCTGCCCACCTC
CCTTTTATTTTTTAAATGCATTAAAAACTGTGCTAGTCTCCTTTGCATGGACTTCAAGCTGCA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001142587.1
Summary 'This gene encodes one subunit of a trimeric complex forming a highly conserved transcription factor that binds with high specificity to CCAAT motifs in the promoters of a variety of genes. The encoded protein, subunit C, forms a tight dimer with the B subunit, a prerequisite for subunit A association. The resulting trimer binds to DNA with high specificity and affinity. Subunits B and C each contain a histone-like motif. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]'
Locus ID 4802

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.