KCNA5 (NM_002234) Human 3' UTR Clone

CAT#: SC209953

3`UTR clone of potassium voltage-gated channel shaker-related subfamily member 5 (KCNA5) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: KCNA5
• Synonyms: ATFB7; HCK1; HK2; HPCN1; KV1.5; PCN1
• ACCN: NM_002234
• Insert Size: 834 bp
• Sequence Data:
  Insert Sequence

  >SC209953 3'UTR clone of NM_002234
  The sequence shown below is from the reference sequence of NM_002234. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCTTTATGCCCTCTGCCTGGACACCAGCCGGGAAACAGATTTGTGAAAGGAGATTCAGGCAGACTGGTGG
  CAGTGGAGTAGGGAATGGGAGGCTTGCTGAACATGGATATCTACATTATACCGCAGAGTATTTGAAGTCA
  CACTGTAACCTCAGTCTACCCCTCTCCTTTCACTCCTTTCCTCCCTCCCTCGATCCCCCCATTTTCTCTA
  TTCTTTCCATGACACCCAAGGGTCGCCTATTTTTAAAAAGTACCACATTCCATGACGCAGGAGCTGTGGA
  AATGGTGAGCGCTGTGAGATGGATGTATTTGTAGCCAGTCTCCTATACCCAGCAGAGGGATAACCCAAAC
  AAAAATGACTCTAAATAGCCCAGATCCCAAGAGATTATGTAACTCCTCCATCCATGTGTTCCAAATTTGC
  TTTACATATGATTGTATTTGTGTATAGGGGAAAATATTATTTTTATGCCTGGTAAGTGGCTTTTTGTACT
  GTAGTTCAGATAGAGATATTTTGGGTATATTTTCAAGATACATGTTGTATTTATGGAAGAAAGAGTTGTC
  CTGATGTTTTTCTGTGTTACTTATATTAGAGTCAGAGATCTTGGTATGGGCTGTTCTGTTTCCTGTGTCT
  CCAAGCCTCTGTCTTTTCTGGGATGTGGTATTGGTGCTTTGTGTCTAGGGCAGAGTATGTTCTTGAAGAA
  AGGCAAATCTGACTTTTTCTGTGCGCCTTAAACAATTCTTGTAACTTTCTTCAAAAAGCATTTTAATGAT
  ATTGGAGGAATACTTCTGATAATTTATTGTCTTTATTTTTATCCCAGGAAATAAAAGGTTACCT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002234.2
• Summary: 'Potassium channels represent the most complex class of voltage-gated ino channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class, the function of which could restore the resting membrane potential of beta cells after depolarization and thereby contribute to the regulation of insulin secretion. This gene is intronless, and the gene is clustered with genes KCNA1 and KCNA6 on chromosome 12. Defects in this gene are a cause of familial atrial fibrillation type 7 (ATFB7). [provided by RefSeq, May 2012]'
• Locus ID: 3741