MCSF Receptor (CSF1R) (NM_005211) Human 3' UTR Clone

CAT#: SC209962

3`UTR clone of colony stimulating factor 1 receptor (CSF1R) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CSF1R
• Synonyms: C-FMS; CD115; CSF-1R; CSFR; FIM2; FMS; HDLS; M-CSF-R
• ACCN: NM_005211
• Insert Size: 798 bp
• Sequence Data:
  Insert Sequence

  >SC209962 3'UTR clone of NM_005211
  The sequence shown below is from the reference sequence of NM_005211. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TATCGCCCAGCCCTTGCTGCAGCCCAACAACTATCAGTTCTGCTGAGGAGTTGACGACAGGGAGTACCAC
  TCTCCCCTCCCACAAACTTCAACTCCTCCATGGATGGGGCGACACGGGGAGAACATACAAACTCTGCCTT
  CGGTCATTTCACTCAACAGCTCGGCCCAGCTCTGAAACTTGGGAAGGTGAGGGATTCAGGGGAGGTCAGA
  GGATCCCACTTCCTGAGCATGGGCCATCACTGCCAGTCAGGGGCTGGGGGCTGAGCCCTCACCCCCCCCT
  CCCCTACTGTTCTCATGGTGTTGGCCTCGTGTTTGCTATGCCAACTAGTAGAACCTTCTTTCCTAATCCC
  CTTATCTTCATGGAAATGGACTGACTTTATGCCTATGAAGTCCCCAGGAGCTACACTGATACTGAGAAAA
  CCAGGCTCTTTGGGGCTAGACAGACTGGCAGAGAGTGAGATCTCCCTCTCTGAGAGGAGCAGCAGATGCT
  CACAGACCACACTCAGCTCAGGCCCCTTGGAGCAGGATGGCTCCTCTAAGAATCTCACAGGACCTCTTAG
  TCTCTGCCCTATACGCCGCCTTCACTCCACAGCCTCACCCCTCCCACCCCCATACTGGTACTGCTGTAAT
  GAGCCAAGTGGCAGCTAAAAGTTGGGGGTGTTCTGCCCAGTCCCGTCATTCTGGGCTAGAAGGCAGGGGA
  CCTTGGCATGTGGCTGGCCACACCAAGCAGGAAGCACAAACTCCCCCAAGCTGACTCATCCTAACTAACA
  GTCACGCCGTGGGATGTCTCTGTCCACA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005211.3
• Summary: 'The protein encoded by this gene is the receptor for colony stimulating factor 1, a cytokine which controls the production, differentiation, and function of macrophages. This receptor mediates most if not all of the biological effects of this cytokine. Ligand binding activates the receptor kinase through a process of oligomerization and transphosphorylation. The encoded protein is a tyrosine kinase transmembrane receptor and member of the CSF1/PDGF receptor family of tyrosine-protein kinases. Mutations in this gene have been associated with a predisposition to myeloid malignancy. The first intron of this gene contains a transcriptionally inactive ribosomal protein L7 processed pseudogene oriented in the opposite direction. Alternative splicing results in multiple transcript variants. Expression of a splice variant from an LTR promoter has been found in Hodgkin lymphoma (HL), HL cell lines and anaplastic large cell lymphoma. [provided by RefSeq, Mar 2017]'
• Locus ID: 1436