TNF alpha (TNF) (NM_000594) Human 3' UTR Clone

CAT#: SC209984

3`UTR clone of tumor necrosis factor (TNF superfamily member 2) (TNF) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TNF
• Synonyms: DIF; TNF-alpha; TNFA; TNFSF2; TNLG1F
• ACCN: NM_000594
• Insert Size: 804 bp
• Sequence Data:
  Insert Sequence

  >SC209984 3'UTR clone of NM_000594
  The sequence shown below is from the reference sequence of NM_000594. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGCAGGTCTACTTTGGGATCATTGCCCTGTGAGGAGGACGAACATCCAACCTTCCCAAACGCCTCCCCTG
  CCCCAATCCCTTTATTACCCCCTCCTTCAGACACCCTCAACCTCTTCTGGCTCAAAAAGAGAATTGGGGG
  CTTAGGGTCGGAACCCAAGCTTAGAACTTTAAGCAACAAGACCACCACTTCGAAACCTGGGATTCAGGAA
  TGTGTGGCCTGCACAGTGAAGTGCTGGCAACCACTAAGAATTCAAACTGGGGCCTCCAGAACTCACTGGG
  GCCTACAGCTTTGATCCCTGACATCTGGAATCTGGAGACCAGGGAGCCTTTGGTTCTGGCCAGAATGCTG
  CAGGACTTGAGAAGACCTCACCTAGAAATTGACACAAGTGGACCTTAGGCCTTCCTCTCTCCAGATGTTT
  CCAGACTTCCTTGAGACACGGAGCCCAGCCCTCCCCATGGAGCCAGCTCCCTCTATTTATGTTTGCACTT
  GTGATTATTTATTATTTATTTATTATTTATTTATTTACAGATGAATGTATTTATTTGGGAGACCGGGGTA
  TCCTGGGGGACCCAATGTAGGAGCTGCCTTGGCTCAGACATGTTTTCCGTGAAAACGGAGCTGAACAATA
  GGCTGTTCCCATGTAGCCCCCTGGCCTCTGTGCCTTCTTTTGATTATGTTTTTTAAAATATTTATCTGAT
  TAAGTTGTCTAAACAATGCTGATTTGGTGACCAACTGTCACTCATTGCTGAGCCTCTGCTCCCCAGGGGA
  GTTGTGTCTGTAATCGCCCTACTATTCAGTGGCG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000594.2
• Summary: 'This gene encodes a multifunctional proinflammatory cytokine that belongs to the tumor necrosis factor (TNF) superfamily. This cytokine is mainly secreted by macrophages. It can bind to, and thus functions through its receptors TNFRSF1A/TNFR1 and TNFRSF1B/TNFBR. This cytokine is involved in the regulation of a wide spectrum of biological processes including cell proliferation, differentiation, apoptosis, lipid metabolism, and coagulation. This cytokine has been implicated in a variety of diseases, including autoimmune diseases, insulin resistance, psoriasis, rheumatoid arthritis ankylosing spondylitis, tuberculosis, autosomal dominant polycystic kidney disease, and cancer. Mutations in this gene affect susceptibility to cerebral malaria, septic shock, and Alzheimer disease. Knockout studies in mice also suggested the neuroprotective function of this cytokine. [provided by RefSeq, Aug 2020]'
• Locus ID: 7124