NF-kB p65 (RELA) (NM_021975) Human 3' UTR Clone

CAT#: SC209996

3`UTR clone of v-rel reticuloendotheliosis viral oncogene homolog A (avian) (RELA) transcript variant 1 for miRNA target validation

Reconstitution Protocol

USD 560.00

5 Days*

Size
    • 10 ug

Product Images

Other products for "RELA"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol RELA
Synonyms CMCU; NFKB3; p65
ACCN NM_021975
Insert Size 827 bp
Sequence Data
>SC209996 3'UTR clone of NM_021975
The sequence shown below is from the reference sequence of NM_021975. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TTGCGGACATGGACTTCTCAGCCCTGCTGAGTCAGATCAGCTCCTAAGGGGGTGACGCCTGCCCTCCCCA
GAGCACTGGGTTGCAGGGGATTGAAGCCCTCCAAAAGCACTTACGGATTCTGGTGGGGTGTGTTCCAACT
GCCCCCAACTTTGTGGATGTCTTCCTTGGAGGGGGGAGCCATATTTTATTCTTTTATTGTCAGTATCTGT
ATCTCTCTCTCTTTTTGGAGGTGCTTAAGCAGAAGCATTAACTTCTCTGGAAAGGGGGGAGCTGGGGAAA
CTCAAACTTTTCCCCTGTCCTGATGGTCAGCTCCCTTCTCTGTAGGGAACTCTGGGGTCCCCCATCCCCA
TCCTCCAGCTTCTGGTACTCTCCTAGAGACAGAAGCAGGCTGGAGGTAAGGCCTTTGAGCCCACAAAGCC
TTATCAAGTGTCTTCCATCATGGATTCATTACAGCTTAATCAAAATAACGCCCCAGATACCAGCCCCTGT
ATGGCACTGGCATTGTCCCTGTGCCTAACACCAGCGTTTGAGGGGCTGGCCTTCCTGCCCTACAGAGGTC
TCTGCCGGCTCTTTCCTTGCTCAACCATGGCTGAAGGAAACCAGTGCAACAGCACTGGCTCTCTCCAGGA
TCCAGAAGGGGTTTGGTCTGGGACTTCCTTGCTCTCCCTCTTCTCAAGTGCCTTAATAGTAGGGTAAGTT
GTTAAGAGTGGGGGAGAGCAGGCTGGCAGCTCTCCAGTCAGGAGGCATAGTTTTTACTGAACAATCAAAG
CACTTGGACTCTTGCTCTTTCTACTCTGAACTAATAAATCTGTTGCCAAGCTGGCTA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_021975.3
Summary 'NF-kappa-B is a ubiquitous transcription factor involved in several biological processes. It is held in the cytoplasm in an inactive state by specific inhibitors. Upon degradation of the inhibitor, NF-kappa-B moves to the nucleus and activates transcription of specific genes. NF-kappa-B is composed of NFKB1 or NFKB2 bound to either REL, RELA, or RELB. The most abundant form of NF-kappa-B is NFKB1 complexed with the product of this gene, RELA. Four transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]'
Locus ID 5970

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.