SERCA2 (ATP2A2) (NM_001681) Human 3' UTR Clone

CAT#: SC210032

3`UTR clone of ATPase Ca++ transporting cardiac muscle slow twitch 2 (ATP2A2) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ATP2A2
• Synonyms: ATP2B; DAR; DD; SERCA2
• ACCN: NM_001681
• Insert Size: 786 bp
• Sequence Data:
  Insert Sequence

  >SC210032 3'UTR clone of NM_001681
  The sequence shown below is from the reference sequence of NM_001681. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAACTACCTGGAACCTGCAATACTGGAGTAACCGCTTCCTAAACCATTTTGCAGAAATGTAAGGGTGTTC
  GGTTGCGTGCATGTGCGTTTTTAGCAACACATCTACCAACCCTGTGCATGACTGATGTTGGGGAAAAAGA
  AAAGTAAAAAACTTCCCAACTCACTTTGTGTTATGTGGAGGAAATGTGTATTACCAATGGGGTTGTTAGC
  TTTTAAATCAAAATACTGATTACAGATGTACAATTTAGCTTAATCAGAAAGCCTCTCCAGAGAAGTTTGG
  TTTCTTTGCTGCAAGAGGAATGAGGCTCTGTAACCTTATCTAAGAACTTGGAAGCCGTCAGCCAAGTCGC
  CACATTTCTCTGCAAAATGTCATAGCTTATATAAATGTACAGTATTCAATTGTAATGCATGCCTTCGGTT
  GTAAGTAGCCAGATCCCTCTCCAGTGACATTGGAACATGCTACTTTTTAATTGGCCCTGTACAGTTTGCT
  TATTTATAAATTCATTAAAAACACTACAGGTGTTGAATGGTTAAAATGTAGGCCTCCAGTTCATTTTCAG
  TTATTTTCTGAGTGTGCAGACAGCTATTTCGCACTGTATTAAATGTAACTTATTTAATGAAATCAGAAGC
  AGTAGACAGATGTTGGTGCAATACAAATATTGTGATGCATTTATCTTAATAAAATGCTAAATGTCAATTT
  ATCACTGCGCATGTTTGACTTTAGACTGTAAATAGAGATCAGTTTGTTTCTTTCTGTGCTGGTAACAATG
  AGCGTCGCACAGACAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001681.3
• Summary: 'This gene encodes one of the SERCA Ca(2+)-ATPases, which are intracellular pumps located in the sarcoplasmic or endoplasmic reticula of the skeletal muscle. This enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol into the sarcoplasmic reticulum lumen, and is involved in regulation of the contraction/relaxation cycle. Mutations in this gene cause Darier-White disease, also known as keratosis follicularis, an autosomal dominant skin disorder characterized by loss of adhesion between epidermal cells and abnormal keratinization. Other types of mutations in this gene have been associated with various forms of muscular dystrophies. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2019]'
• Locus ID: 488