VASP (NM_003370) Human 3' UTR Clone

CAT#: SC210104

3`UTR clone of vasodilator-stimulated phosphoprotein (VASP) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "VASP"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol VASP
Synonyms vasodilator-stimulated phosphoprotein
ACCN NM_003370
Insert Size 847 bp
Sequence Data
>SC210104 3'UTR clone of NM_003370
The sequence shown below is from the reference sequence of NM_003370. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CATTGAAGCCTTCGTCCAGGAGCTGAGGAAGCGGGGTTCTCCCTGACCACAGGGACCCAGAAGACCCGCT
TCTCCTTTCCGCACACCCGGCCTGTCACCCTGCTTTCCCTGCCTCTACTTGACTTGGAATTGGCTGAAGA
CTACACAGGAATGCATCGTTCCCACTCCCCATCCCACTTGGAAAACTCCAAGGGGGTGTGGCTTCCCTGC
TCACACCCACACTGGCTGCTGATTGGCTGGGGAGGCCCCCGCCCTTTTCTCCCTTTGGTCCTTCCCCTCT
GCCATCCCCTTGGGGCCGGTCCCTCTGCTGGGGATGCACCAATGAACCCCACAGGAAGGGGGAAGGAAGG
AGGGAATTTCACATTCCCTTGTTCTAGATTCACTTTAACGCTTAATGCCTTCAAAGTTTTGGTTTTTTTA
AGAAAAAAAAATATATATATATTTGGGTTTTGGGGGAAAAGGGAAATTTTTTTTTCTCTTTGGTTTTGAT
AAAATGGGATGTGGGAGTTTTTAAATGCTATAGCCCTGGGCTTGCCCCATTTGGGGCAGCTATTTAAGGG
GAGGGGATGTCTCACCGGGCTGGGGGTGAGATATCCCCCCACCCCAGGGACTCCCCTTCCCTCTGGCTCC
TTCCCCTTTTCTATGAGGAAATAAGATGCTGTAACTTTTTGGAACCTCAGTTTTTTGATTTTTTATTTGG
GTAGGTTTTGGGGTCCAGGCCATTTTTTTTACCCCTTGGAGGAAATAAGATGAGGGAGAAAGGAGAAGGG
GAGGAAACTTCTCCCCTCCCACCTTCACCTTTAGCTTCTTGAAAATGGGCCCCTGCAGAATAAATCTGCC
AGTTTTT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_003370.3
Summary 'Vasodilator-stimulated phosphoprotein (VASP) is a member of the Ena-VASP protein family. Ena-VASP family members contain an EHV1 N-terminal domain that binds proteins containing E/DFPPPPXD/E motifs and targets Ena-VASP proteins to focal adhesions. In the mid-region of the protein, family members have a proline-rich domain that binds SH3 and WW domain-containing proteins. Their C-terminal EVH2 domain mediates tetramerization and binds both G and F actin. VASP is associated with filamentous actin formation and likely plays a widespread role in cell adhesion and motility. VASP may also be involved in the intracellular signaling pathways that regulate integrin-extracellular matrix interactions. VASP is regulated by the cyclic nucleotide-dependent kinases PKA and PKG. [provided by RefSeq, Jul 2008]'
Locus ID 7408

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.