p73 (TP73) (NM_001126240) Human 3' UTR Clone

CAT#: SC210190

3`UTR clone of tumor protein p73 (TP73) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "TP73"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol TP73
Synonyms P73
ACCN NM_001126240
Insert Size 835 bp
Sequence Data
>SC210190 3'UTR clone of NM_001126240
The sequence shown below is from the reference sequence of NM_001126240. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCATCAAGGAGGAGTTCACGGAGGCCGAGATCCACTGAGGGCCTCGCCTGGCTGCAGCCTGCGCCACCGC
CCAGAGACCCAAGCTGCCTCCCCTCTCCTTCCTGTGTGTCCAAAACTGCCTCAGGAGGCAGGACCTTCGG
GCTGTGCCCGGGGAAAGGCAAGGTCCGGCCCATCCCCAGGCACCTCACAGGCCCCAGGAAAGGCCCAGCC
ACCGAAGCCGCCTGTGGACAGCCTGAGTCACCTGCAGAACCTTCTGGAGCTGCCCTAGTGCTGGGCTTGT
GGGGCGGGGGCTGGCCCACTCTCAGCCCTGCCACTGCCCCGGCGTGCTCCATGGCAGGCGTGGGTGGGGA
CCGCAGCGTCGGCTCCGACTTCCAGGCTTCATCCTAGAGACTGTCATCTCCCAACCAGGCGAGGTCCTTC
CAAAGGAAAGGATCCTCTTTGCTGATGGACTGCCAAAAAGTATTTTGCGACATCTTTTGGTTCTGGATAG
TAGTGAGCAGCCAAGTGACTGTGTCTGAAACACCAGTGTATTTTCAGGGAATGTCCCTAACTGCGTCTTG
CCCGCGCCGGGGGCTGGGGACTCTCTCTGCTGGACTTGGGACTGGCCTCTGCCCCCAGCACGCTGTATTC
TGCAGGACCGCCTCCTTCCTGCCCCTAACAACAACCACAGTGTTGCTGAAATTGGAGAAAACTGGGGAGG
GCGCAACCCCCCCCAGGCGCGGGGAAGCATGTGGTACCGCCTCAGCCAGTGCCCCTCAGCCTGGCCACAG
TCGCCTCTCCTCGGGGACCCCTCAGCAGAAAGGGACAGCCTGTCCTTAGAGGACTGGAAATTGTC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001126240.1
Summary 'This gene encodes a member of the p53 family of transcription factors involved in cellular responses to stress and development. It maps to a region on chromosome 1p36 that is frequently deleted in neuroblastoma and other tumors, and thought to contain multiple tumor suppressor genes. The demonstration that this gene is monoallelically expressed (likely from the maternal allele), supports the notion that it is a candidate gene for neuroblastoma. Many transcript variants resulting from alternative splicing and/or use of alternate promoters have been found for this gene, but the biological validity and the full-length nature of some variants have not been determined. [provided by RefSeq, Feb 2011]'
Locus ID 7161

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.