CYP27B1 (NM_000785) Human 3' UTR Clone

CAT#: SC210195

3`UTR clone of cytochrome P450 family 27 subfamily B polypeptide 1 (CYP27B1) nuclear gene encoding mitochondrial protein for miRNA target validation

Reconstitution Protocol

USD 560.00

5 Days*

Size
    • 10 ug

Product Images

Other products for "CYP27B1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CYP27B1
Synonyms CP2B; CYP1; CYP1alpha; CYP27B; P450c1; PDDR; VDD1; VDDR; VDDRI; VDR
ACCN NM_000785
Insert Size 832 bp
Sequence Data
>SC210195 3'UTR clone of NM_000785
The sequence shown below is from the reference sequence of NM_000785. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCTGAAAGGAGCATCAACCTACAGTTTTTGGACAGATAGTCCCATGGAAAGAGACTGTCATCATCACCCT
TTCATTCATCATAGGGATAAGATTTTTTGTAGGCACAAGACCAAGGTATACATCTTCCCCTAATGCCTAT
CTGACCAAACTGGATAGAACCACCATAGTGAAGTGTGAGGCGGCCCTGACCAATGTGTGAAGTATGCACT
TGGCCTGACTCAGGAAGCCAGGTGAGAAAACCATGGTCTCTCTGCTTGCTTGGCCCTTCTGATCATGTAT
GCATCCCCCAAGGATGAAATCAGATTTTAACTAATAATGCTGGATGGCCTGAGGAAAGATTCAACTGCCT
CTCTTTTTGGGCTTTCATAGTGTTCATTGATGCTGCTGGCTAAGCATTTATCAAAGCATAAGCTCAGTAA
CTGTGCATCTGGTCTGTACCTGGTTGGTCCTTCGTCTTTGCATGTAAGCTCTTTGAGAGGAAGGGTGAAG
CCTTATTTGTTTTTTATGTCCCCTGCCAGGGCCTGTCTCTGACTAGGTGTCACCATACACATTCTTAGAT
TGAATCTGAACCATGTGGCAGAAGGGATAAGCAGCTTACTTAGTAGGCTCTGTCTACCCCCTTCCTTCTT
TGTCTTGCCCCTAGGAAGGTGAATCTGCCCTAGCCTGGTTTACGGTTTCTTATAACTCTCCTTTGCTCTC
TGGCCACTATTAAGTGGGTTTGCCCCATCACTTAGTTCTCAGGCAGAGACATCTTTGGGCCTGTCCCTGC
CCAGGCCTCTGGCTTTTTATATTGAAAATTTTTAAATATTCACAAATTTTAGAATAAATCAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_000785.3
Summary 'This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The protein encoded by this gene localizes to the inner mitochondrial membrane where it hydroxylates 25-hydroxyvitamin D3 at the 1alpha position. This reaction synthesizes 1alpha,25-dihydroxyvitamin D3, the active form of vitamin D3, which binds to the vitamin D receptor and regulates calcium metabolism. Thus this enzyme regulates the level of biologically active vitamin D and plays an important role in calcium homeostasis. Mutations in this gene can result in vitamin D-dependent rickets type I. [provided by RefSeq, Jul 2008]'
Locus ID 1594

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.