EGF (NM_001963) Human 3' UTR Clone

CAT#: SC210325

3`UTR clone of epidermal growth factor (beta-urogastrone) (EGF) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: EGF
• Synonyms: HOMG4; URG
• ACCN: NM_001963
• Insert Size: 808 bp
• Sequence Data:
  Insert Sequence

  >SC210325 3'UTR clone of NM_001963
  The sequence shown below is from the reference sequence of NM_001963. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCACACCAAATGGAGCTGACTCAGTGAAAACTGGAATTAAAAGGAAAGTCAAGAAGAATGAACTATGTCG
  ATGCACAGTATCTTTTCTTTCAAAAGTAGAGCAAAACTATAGGTTTTGGTTCCACAATCTCTACGACTAA
  TCACCTACTCAATGCCTGGAGACAGATACGTAGTTGTGCTTTTGTTTGCTCTTTTAAGCAGTCTCACTGC
  AGTCTTATTTCCAAGTAAGAGTACTGGGAGAATCACTAGGTAACTTATTAGAAACCCAAATTGGGACAAC
  AGTGCTTTGTAAATTGTGTTGTCTTCAGCAGTCAATACAAATAGATTTTTGTTTTTGTTGTTCCTGCAGC
  CCCAGAAGAAATTAGGGGTTAAAGCAGACAGTCACACTGGTTTGGTCAGTTACAAAGTAATTTCTTTGAT
  CTGGACAGAACATTTATATCAGTTTCATGAAATGATTGGAATATTACAATACCGTTAAGATACAGTGTAG
  GCATTTAACTCCTCATTGGCGTGGTCCATGCTGATGATTTTGCAAAATGAGTTGTGATGAATCAATGAAA
  AATGTAATTTAGAAACTGATTTCTTCAGAATTAGATGGCTTATTTTTTAAAATATTTGAATGAAAACATT
  TTATTTTTAAAATATTACACAGGAGGCTTCGGAGTTTCTTAGTCATTACTGTCCTTTTCCCCTACAGAAT
  TTTCCCTCTTGGTGTGATTGCACAGAATTTGTATGTATTTTCAGTTACAAGATTGTAAGTAAATTGCCTG
  ATTTGTTTTCATTATAGACAACGATGAATTTCTTCTAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001963.3
• Summary: 'This gene encodes a member of the epidermal growth factor superfamily. The encoded preproprotein is proteolytically processed to generate the 53-amino acid epidermal growth factor peptide. This protein acts a potent mitogenic factor that plays an important role in the growth, proliferation and differentiation of numerous cell types. This protein acts by binding with high affinity to the cell surface receptor, epidermal growth factor receptor. Defects in this gene are the cause of hypomagnesemia type 4. Dysregulation of this gene has been associated with the growth and progression of certain cancers. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. [provided by RefSeq, Jan 2016]'
• Locus ID: 1950