OGG1 (NM_016827) Human 3' UTR Clone

CAT#: SC210394

3`UTR clone of 8-oxoguanine DNA glycosylase (OGG1) nuclear gene encoding mitochondrial protein transcript variant 2c for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "OGG1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol OGG1
Synonyms HMMH; HOGG1; MUTM; OGH1
ACCN NM_016827
Insert Size 835 bp
Sequence Data
>SC210394 3'UTR clone of NM_016827
The sequence shown below is from the reference sequence of NM_016827. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GCCTCCTTGGCAATGCATTTGATGGCCACCAGCTTCTGCGTCCTCTTATCTTCTGCCAGGATCACCTCCG
AGAAGGCCCCCCTATCGGGAGAGGGGATTCACAAGGTGAAGAACTGGAACCCCAGCTTCCCTCCAGCCTC
TCCTCCATTCCCTATGGGTTCTGTGACCACTGCTGGACCAAGGACGTGGATGACCCTCCCCTAGTCACTC
ATCCATCCCCTGGCTCCAGAGATGGTCACATGACCCAGGCCTGGCCAGTCAAAGTAGTCTCTCCCCTGGC
CACAGTAATTGGTCATGTGATGCAAGCCAGCTTACTAGCACTTTGAGAATGAGTCTCCTGTTGAGCTGGT
AGGATGTAAGCCTGGAGCTAATGGCGATCATCTTTGCCACCACCTGGGGAGAGCCTGCTTGGGAATGAAA
TTAACACAAAGGAAGTCCAACCTGAGAAATGGCCAAATATATTTCCTGATAACATTATGTGGCCCTCTGG
ATCCAGCCATGCCTGAGGTCTACCCCTGGGCTTTTGGATTATGTGTACAGTTGGTTCATCCCTTTTTCTG
CTAATTCGAGTCATGGCTAATTTAACACCCTTTAGAACCTTAAAGAACCATCAGCATCACCCGGGAACTT
TTTTAGAAATGCAAAATCTCTACTGCTTTGGATCCTGGGTCAAAAAAAAGAAAAAAAAAAGAAATGCAAA
ACTTTAGGCCCTGCCCCAGATTTACTAAATCAATCTGCAGTTTAACAAAATCCTCAGGTGATTTGTATGC
TCATTGAACTTTAAGAAGCAGTGTTTTAGAACAGGTTCTTAAAAAGGAACAAATAAACTCATTTA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_016827.2
Summary 'This gene encodes the enzyme responsible for the excision of 8-oxoguanine, a mutagenic base byproduct which occurs as a result of exposure to reactive oxygen. The action of this enzyme includes lyase activity for chain cleavage. Alternative splicing of the C-terminal region of this gene classifies splice variants into two major groups, type 1 and type 2, depending on the last exon of the sequence. Type 1 alternative splice variants end with exon 7 and type 2 end with exon 8. All variants share the N-terminal region in common, which contains a mitochondrial targeting signal that is essential for mitochondrial localization. Many alternative splice variants for this gene have been described, but the full-length nature for every variant has not been determined. [provided by RefSeq, Aug 2008]'
Locus ID 4968

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.