CACNA1A (NM_001127222) Human 3' UTR Clone

CAT#: SC210646

3`UTR clone of calcium channel voltage-dependent P/Q type alpha 1A subunit (CACNA1A) transcript variant 4 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CACNA1A"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CACNA1A
Synonyms APCA; BI; CACNL1A4; CAV2.1; EA2; EIEE42; FHM; HPCA; MHP; MHP1; SCA6
ACCN NM_001127222
Insert Size 872 bp
Sequence Data
>SC210646 3'UTR clone of NM_001127222
The sequence shown below is from the reference sequence of NM_001127222. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TACAGCGAGAGTGACGATGATTGGTGCTAAGCCCGGGCGAGGTGGCGCCCGCCCGGCCCCCCACGCACCC
CACGCACACACCCCACCCGAGGAGCCGCGCAGAGGCCGCGGGGGCCCAGCACAGAGGGCCCGGGAGAGGG
CCAGCCGGGAGACCCCAGACTCTGGAGAGGCCAGGGCTGGGCCACAAGGGTGTCCCGCAGAGACCCTCGG
CCAAAAGAGACCCTCCTGGGCAGCCACGGCGCCCCCCAACCAGCCCCGATCCCCCCACCCACGACAGGGG
CTCTCGGGTGGGAGGCAGGGAGCAGACAAACCACACAGCCAAGGGATTTGAATTAACTCAGCCATTTTTG
GAGAACTTTGGGGAACATGAAAAAAAAAAAAAAAAAAAAAAAAAAAAACATTTTTAAAAGAAAAAACGGG
GAGAAAAAAATAGCTTCTATTGATGAGTTTTATCATCTCAATTGAATCTTTCCTTTCCCTGATGAAGACA
GCTGGTGGCCGAGTGCGGCAAAGAAGCCAGAAGGAACCAGAATCCCAGTGCCCTACACCCACCACCAGAC
ACACTCACACCCACACACGTTCTCAGACACACACAAGAGTGCTTGCCGGTTATACCAAACCCTACTATTA
CTGCCTGCAGAAATCAATTTAAAAAAATAATAATAACAATAAACAATTTTAAAAAGGACAAAAAAATTAA
TGATTGAGAAAAGAGGCATTTTTTTCTGACATTTGGTCCTGCTTGAAACAACAAAAGAAGAAGAAAAACC
CACCATCACCACCGATTCCTTTGCTTCTTTTTTCCTTTTTTCCTACCTTGTTTGAAAACCGTGGGCTTGG
GACTGTGAATTATTGCATGACATTCAAAAAGA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001127222.1
Summary 'Voltage-dependent calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. Calcium channels are multisubunit complexes composed of alpha-1, beta, alpha-2/delta, and gamma subunits. The channel activity is directed by the pore-forming alpha-1 subunit, whereas, the others act as auxiliary subunits regulating this activity. The distinctive properties of the calcium channel types are related primarily to the expression of a variety of alpha-1 isoforms, alpha-1A, B, C, D, E, and S. This gene encodes the alpha-1A subunit, which is predominantly expressed in neuronal tissue. Mutations in this gene are associated with 2 neurologic disorders, familial hemiplegic migraine and episodic ataxia 2. This gene also exhibits polymorphic variation due to (CAG)n-repeats. Multiple transcript variants encoding different isoforms have been found for this gene. In one set of transcript variants, the (CAG)n-repeats occur in the 3' UTR, and are not associated with any disease. But in another set of variants, an insertion extends the coding region to include the (CAG)n-repeats which encode a polyglutamine tract. Expansion of the (CAG)n-repeats from the normal 4-18 to 21-33 in the coding region is associated with spinocerebellar ataxia 6. [provided by RefSeq, Jul 2016]'
Locus ID 773

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.